ID: 1003714552

View in Genome Browser
Species Human (GRCh38)
Location 6:8632001-8632023
Sequence AGGTTGTGATCACAAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003714552_1003714554 2 Left 1003714552 6:8632001-8632023 CCTCTCTCTTGTGATCACAACCT No data
Right 1003714554 6:8632026-8632048 AATCCAGCCACCATATTGAAAGG No data
1003714552_1003714558 21 Left 1003714552 6:8632001-8632023 CCTCTCTCTTGTGATCACAACCT No data
Right 1003714558 6:8632045-8632067 AAGGAAGCCCAAGAAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003714552 Original CRISPR AGGTTGTGATCACAAGAGAG AGG (reversed) Intergenic