ID: 1003714558

View in Genome Browser
Species Human (GRCh38)
Location 6:8632045-8632067
Sequence AAGGAAGCCCAAGAAATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003714553_1003714558 1 Left 1003714553 6:8632021-8632043 CCTAAAATCCAGCCACCATATTG No data
Right 1003714558 6:8632045-8632067 AAGGAAGCCCAAGAAATCAATGG No data
1003714555_1003714558 -7 Left 1003714555 6:8632029-8632051 CCAGCCACCATATTGAAAGGAAG No data
Right 1003714558 6:8632045-8632067 AAGGAAGCCCAAGAAATCAATGG No data
1003714551_1003714558 27 Left 1003714551 6:8631995-8632017 CCATTTCCTCTCTCTTGTGATCA No data
Right 1003714558 6:8632045-8632067 AAGGAAGCCCAAGAAATCAATGG No data
1003714552_1003714558 21 Left 1003714552 6:8632001-8632023 CCTCTCTCTTGTGATCACAACCT No data
Right 1003714558 6:8632045-8632067 AAGGAAGCCCAAGAAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003714558 Original CRISPR AAGGAAGCCCAAGAAATCAA TGG Intergenic