ID: 1003722078

View in Genome Browser
Species Human (GRCh38)
Location 6:8715032-8715054
Sequence CAGTGCAGATGGAGAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003722078_1003722084 27 Left 1003722078 6:8715032-8715054 CCTTCTGTTCTCCATCTGCACTG No data
Right 1003722084 6:8715082-8715104 GCAGACTCCAGATCAAATGCTGG No data
1003722078_1003722081 -5 Left 1003722078 6:8715032-8715054 CCTTCTGTTCTCCATCTGCACTG No data
Right 1003722081 6:8715050-8715072 CACTGTTGGATGTAGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003722078 Original CRISPR CAGTGCAGATGGAGAACAGA AGG (reversed) Intergenic
No off target data available for this crispr