ID: 1003733118

View in Genome Browser
Species Human (GRCh38)
Location 6:8848406-8848428
Sequence CTCCAAAAACAGGTGGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003733118_1003733121 6 Left 1003733118 6:8848406-8848428 CCAAGATCCACCTGTTTTTGGAG No data
Right 1003733121 6:8848435-8848457 AATTTGAAATTCTCTCTATAAGG No data
1003733118_1003733122 30 Left 1003733118 6:8848406-8848428 CCAAGATCCACCTGTTTTTGGAG No data
Right 1003733122 6:8848459-8848481 AATTTGATGATTCAATGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003733118 Original CRISPR CTCCAAAAACAGGTGGATCT TGG (reversed) Intergenic
No off target data available for this crispr