ID: 1003735373

View in Genome Browser
Species Human (GRCh38)
Location 6:8872290-8872312
Sequence CTGGAAACAAAGATAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003735373_1003735375 1 Left 1003735373 6:8872290-8872312 CCATGTTTTATCTTTGTTTCCAG No data
Right 1003735375 6:8872314-8872336 TTTAGAAGTTTAAATATGCATGG No data
1003735373_1003735376 9 Left 1003735373 6:8872290-8872312 CCATGTTTTATCTTTGTTTCCAG No data
Right 1003735376 6:8872322-8872344 TTTAAATATGCATGGTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003735373 Original CRISPR CTGGAAACAAAGATAAAACA TGG (reversed) Intergenic
No off target data available for this crispr