ID: 1003737294

View in Genome Browser
Species Human (GRCh38)
Location 6:8890979-8891001
Sequence AAAATACTGTCTATGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003737291_1003737294 2 Left 1003737291 6:8890954-8890976 CCTGTTAAACTCATTGGCATGCT No data
Right 1003737294 6:8890979-8891001 AAAATACTGTCTATGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003737294 Original CRISPR AAAATACTGTCTATGAAGGT GGG Intergenic
No off target data available for this crispr