ID: 1003740761

View in Genome Browser
Species Human (GRCh38)
Location 6:8935895-8935917
Sequence GGCTCAACTTGAGGTGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003740761_1003740765 27 Left 1003740761 6:8935895-8935917 CCTTTGGCACCTCAAGTTGAGCC No data
Right 1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003740761 Original CRISPR GGCTCAACTTGAGGTGCCAA AGG (reversed) Intergenic
No off target data available for this crispr