ID: 1003740762

View in Genome Browser
Species Human (GRCh38)
Location 6:8935904-8935926
Sequence GTGGTTTCTGGCTCAACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003740762_1003740766 28 Left 1003740762 6:8935904-8935926 CCTCAAGTTGAGCCAGAAACCAC No data
Right 1003740766 6:8935955-8935977 TTCCTCCAACAGGTTCAGTTAGG No data
1003740762_1003740765 18 Left 1003740762 6:8935904-8935926 CCTCAAGTTGAGCCAGAAACCAC No data
Right 1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003740762 Original CRISPR GTGGTTTCTGGCTCAACTTG AGG (reversed) Intergenic
No off target data available for this crispr