ID: 1003740763

View in Genome Browser
Species Human (GRCh38)
Location 6:8935916-8935938
Sequence TTCATCTTCAGAGTGGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003740763_1003740766 16 Left 1003740763 6:8935916-8935938 CCAGAAACCACTCTGAAGATGAA No data
Right 1003740766 6:8935955-8935977 TTCCTCCAACAGGTTCAGTTAGG No data
1003740763_1003740765 6 Left 1003740763 6:8935916-8935938 CCAGAAACCACTCTGAAGATGAA No data
Right 1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG No data
1003740763_1003740769 26 Left 1003740763 6:8935916-8935938 CCAGAAACCACTCTGAAGATGAA No data
Right 1003740769 6:8935965-8935987 AGGTTCAGTTAGGAAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003740763 Original CRISPR TTCATCTTCAGAGTGGTTTC TGG (reversed) Intergenic
No off target data available for this crispr