ID: 1003740764

View in Genome Browser
Species Human (GRCh38)
Location 6:8935923-8935945
Sequence GTCTCACTTCATCTTCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003740764_1003740765 -1 Left 1003740764 6:8935923-8935945 CCACTCTGAAGATGAAGTGAGAC No data
Right 1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG No data
1003740764_1003740769 19 Left 1003740764 6:8935923-8935945 CCACTCTGAAGATGAAGTGAGAC No data
Right 1003740769 6:8935965-8935987 AGGTTCAGTTAGGAAAAGATAGG No data
1003740764_1003740766 9 Left 1003740764 6:8935923-8935945 CCACTCTGAAGATGAAGTGAGAC No data
Right 1003740766 6:8935955-8935977 TTCCTCCAACAGGTTCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003740764 Original CRISPR GTCTCACTTCATCTTCAGAG TGG (reversed) Intergenic
No off target data available for this crispr