ID: 1003740765

View in Genome Browser
Species Human (GRCh38)
Location 6:8935945-8935967
Sequence CACAAGAACTTTCCTCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003740761_1003740765 27 Left 1003740761 6:8935895-8935917 CCTTTGGCACCTCAAGTTGAGCC No data
Right 1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG No data
1003740764_1003740765 -1 Left 1003740764 6:8935923-8935945 CCACTCTGAAGATGAAGTGAGAC No data
Right 1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG No data
1003740762_1003740765 18 Left 1003740762 6:8935904-8935926 CCTCAAGTTGAGCCAGAAACCAC No data
Right 1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG No data
1003740763_1003740765 6 Left 1003740763 6:8935916-8935938 CCAGAAACCACTCTGAAGATGAA No data
Right 1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003740765 Original CRISPR CACAAGAACTTTCCTCCAAC AGG Intergenic
No off target data available for this crispr