ID: 1003747056

View in Genome Browser
Species Human (GRCh38)
Location 6:9014142-9014164
Sequence AATTGCCTACAGACTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003747054_1003747056 6 Left 1003747054 6:9014113-9014135 CCTATTCTTCTGGGGCTATTAAA No data
Right 1003747056 6:9014142-9014164 AATTGCCTACAGACTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003747056 Original CRISPR AATTGCCTACAGACTTCTGT GGG Intergenic
No off target data available for this crispr