ID: 1003751799

View in Genome Browser
Species Human (GRCh38)
Location 6:9066856-9066878
Sequence GAGAACAGTACGAGGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003751799_1003751809 23 Left 1003751799 6:9066856-9066878 CCCCCAACCCTCGTACTGTTCTC No data
Right 1003751809 6:9066902-9066924 AAGAACCTACATAAACCCTTGGG No data
1003751799_1003751808 22 Left 1003751799 6:9066856-9066878 CCCCCAACCCTCGTACTGTTCTC No data
Right 1003751808 6:9066901-9066923 TAAGAACCTACATAAACCCTTGG No data
1003751799_1003751810 24 Left 1003751799 6:9066856-9066878 CCCCCAACCCTCGTACTGTTCTC No data
Right 1003751810 6:9066903-9066925 AGAACCTACATAAACCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003751799 Original CRISPR GAGAACAGTACGAGGGTTGG GGG (reversed) Intergenic
No off target data available for this crispr