ID: 1003753472

View in Genome Browser
Species Human (GRCh38)
Location 6:9089102-9089124
Sequence TGTACACAGAGCACTGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003753471_1003753472 -10 Left 1003753471 6:9089089-9089111 CCAAAAATCATAGTGTACACAGA No data
Right 1003753472 6:9089102-9089124 TGTACACAGAGCACTGCAATTGG No data
1003753470_1003753472 5 Left 1003753470 6:9089074-9089096 CCTGTTCTTCATGAGCCAAAAAT No data
Right 1003753472 6:9089102-9089124 TGTACACAGAGCACTGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003753472 Original CRISPR TGTACACAGAGCACTGCAAT TGG Intergenic
No off target data available for this crispr