ID: 1003755872

View in Genome Browser
Species Human (GRCh38)
Location 6:9119230-9119252
Sequence CACAGCTACCACGTTTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003755866_1003755872 29 Left 1003755866 6:9119178-9119200 CCAAAGATGCCAATGTGGATAGT No data
Right 1003755872 6:9119230-9119252 CACAGCTACCACGTTTCTGAAGG No data
1003755867_1003755872 20 Left 1003755867 6:9119187-9119209 CCAATGTGGATAGTTTGTCGTCC No data
Right 1003755872 6:9119230-9119252 CACAGCTACCACGTTTCTGAAGG No data
1003755869_1003755872 -1 Left 1003755869 6:9119208-9119230 CCTTGAAATGTGGTGTGACCCTC No data
Right 1003755872 6:9119230-9119252 CACAGCTACCACGTTTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003755872 Original CRISPR CACAGCTACCACGTTTCTGA AGG Intergenic
No off target data available for this crispr