ID: 1003758374

View in Genome Browser
Species Human (GRCh38)
Location 6:9148288-9148310
Sequence GATGGTTGAGTGCTGCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 642
Summary {0: 45, 1: 62, 2: 148, 3: 143, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003758374_1003758377 -10 Left 1003758374 6:9148288-9148310 CCAAGTGGCAGCACTCAACCATC 0: 45
1: 62
2: 148
3: 143
4: 244
Right 1003758377 6:9148301-9148323 CTCAACCATCAAAGGCCAGGTGG No data
1003758374_1003758382 18 Left 1003758374 6:9148288-9148310 CCAAGTGGCAGCACTCAACCATC 0: 45
1: 62
2: 148
3: 143
4: 244
Right 1003758382 6:9148329-9148351 ACTACCGTAATGGACAGCAGAGG No data
1003758374_1003758378 -9 Left 1003758374 6:9148288-9148310 CCAAGTGGCAGCACTCAACCATC 0: 45
1: 62
2: 148
3: 143
4: 244
Right 1003758378 6:9148302-9148324 TCAACCATCAAAGGCCAGGTGGG No data
1003758374_1003758381 8 Left 1003758374 6:9148288-9148310 CCAAGTGGCAGCACTCAACCATC 0: 45
1: 62
2: 148
3: 143
4: 244
Right 1003758381 6:9148319-9148341 GGTGGGTGTAACTACCGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003758374 Original CRISPR GATGGTTGAGTGCTGCCACT TGG (reversed) Intergenic
901316228 1:8311324-8311346 TCTGGTTGAGAGCTGCCCCTGGG - Intergenic
901444282 1:9298029-9298051 GATGGCTGAGTACTGCCACTTGG - Intronic
901904302 1:12394445-12394467 GACGATTGAGTGCTGCCACTTGG + Intronic
904179997 1:28659510-28659532 GATGGTTGAGTGTTGCCACTTGG + Intergenic
904494983 1:30881528-30881550 GAAGGTTCAGTGCTTCCACCGGG - Intronic
904815125 1:33190357-33190379 GATGGTTAAGTGCTGCTACCTGG + Intergenic
905353832 1:37367014-37367036 GATGGTTGAGTGCTGCCACTTGG - Intergenic
905464979 1:38146330-38146352 GATGGTTGAGTGCTGCCACTTGG - Intergenic
906055154 1:42910148-42910170 GACAGTTTAGTGCTGCTACTTGG + Intergenic
907597107 1:55730317-55730339 GATGGTTCAGTGCTTCCACTTGG - Intergenic
907603106 1:55789644-55789666 GGTGATTCAGTGTTGCCACTTGG + Intergenic
908616477 1:65928486-65928508 GAAGGTTGAGTGCCACCACTTGG + Intronic
908737324 1:67290312-67290334 GACAGTCGAGTGCTGCTACTTGG - Intergenic
909032859 1:70562045-70562067 AATGGTTGAGTGCCACCACTTGG - Intergenic
909215151 1:72877517-72877539 GAGGGAGGAATGCTGCCACTAGG + Intergenic
909576673 1:77184085-77184107 GACAGCTGAGTGATGCCACTTGG - Intronic
909810770 1:79929791-79929813 GATGGTTGAGTGCCACCACTTGG - Intergenic
910027712 1:82678313-82678335 GATTTTTGAGTGCAGCCTCTGGG - Intergenic
910561673 1:88598223-88598245 GATGATTGAGTACTGCCACTTGG - Intergenic
910587974 1:88899965-88899987 GACGGTTGAGTGCCACCACTTGG - Intergenic
910639207 1:89441734-89441756 GACGGTTGAGTCCTGCCACTTGG + Intergenic
910790181 1:91042667-91042689 GATGGTGGGGTGCTGCCACTTGG - Intergenic
910831388 1:91465480-91465502 GATGGTTGAGTGCTGCCACTTGG + Intergenic
910948190 1:92616391-92616413 GATGGTTGAGTGCTGCCACTTGG - Intronic
911109345 1:94165968-94165990 GATGGTTGAGTGTCACCACTTGG + Intronic
911883336 1:103268699-103268721 GATGGTTGATTGCCGCCACTTGG - Intergenic
912733558 1:112130596-112130618 GACAGTTGAGTGCCACCACTTGG + Intergenic
912944052 1:114069958-114069980 TATGGTTGAGTGCTGCCACTTGG + Intergenic
914737686 1:150433965-150433987 GATGGTTCAGTGCTTCTTCTTGG - Intronic
915100093 1:153492967-153492989 GATGCTTGAGTTATTCCACTTGG + Intergenic
915362427 1:155294264-155294286 GATGATTGGGCGCTGCAACTTGG - Exonic
916029607 1:160864361-160864383 CAGGGTTGAGGGCTGCCCCTTGG - Intergenic
917217453 1:172692682-172692704 GACAGTTGAGTGCTGCCGCTTGG + Intergenic
917352283 1:174090705-174090727 GATGATTAAATGCTGCCACCTGG + Intergenic
917462488 1:175244449-175244471 GACAGTTGAGTGCTGCCACTTGG - Intergenic
917764474 1:178201616-178201638 GACAGTTGAGTGCCACCACTTGG - Intronic
918030277 1:180801114-180801136 GATAGTTAAGTGCTGCCATCTGG + Intronic
918814865 1:189169486-189169508 GATGGTTGAGTGTTGCCCCTTGG - Intergenic
918918453 1:190673605-190673627 GATGGTTGAGTGCTGCCACTTGG + Intergenic
918958032 1:191236259-191236281 GATGGTTGAGTGCTGCCACTCGG - Intergenic
919124890 1:193381914-193381936 GATGGTTGAGTGCCGCCGCTTGG + Intergenic
919130408 1:193443329-193443351 GGCAGTTGAGTGTTGCCACTTGG - Intergenic
919241566 1:194922727-194922749 ATGGGTTGAGTGTTGCCACTTGG - Intergenic
920197188 1:204236593-204236615 GATGGTTGAGTGCCACCACTTGG - Intronic
921313254 1:213866619-213866641 TTTGGTTGAGGGTTGCCACTAGG + Intergenic
922080719 1:222293285-222293307 ATTGGTTAAGTGCTGCCCCTGGG - Intergenic
1064132153 10:12719681-12719703 AGTGGTTCAGTGCTGGCACTGGG - Intronic
1064517889 10:16170004-16170026 GATGGTTGAGTGCCGCCACTTGG + Intergenic
1066167271 10:32801023-32801045 GATGGTTGAGTGCCACCGCTTGG + Intronic
1066543492 10:36474697-36474719 GATGGTTGAGTGCTGCGACTTGG - Intergenic
1066957566 10:42187633-42187655 GAGGGTTGAGTGCTAACACTTGG - Intergenic
1067125831 10:43514656-43514678 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1067332916 10:45338445-45338467 GATGGTTGAGTGCCACCACTTGG - Intergenic
1067754582 10:48995488-48995510 GATGATTGAGTGCCGCCACTTGG + Intergenic
1068225584 10:54103371-54103393 GATGGTTGAGCGCCACCACTTGG + Intronic
1068836998 10:61566776-61566798 GAGGGAGGAATGCTGCCACTAGG - Intergenic
1068837482 10:61570371-61570393 CACAGTTGAGTGCTGCCACTTGG + Intergenic
1069140039 10:64811098-64811120 GGTGGTTGAGTTCCACCACTTGG + Intergenic
1069145518 10:64888421-64888443 GACAGTTGAGTGCTGCCACTTGG - Intergenic
1069192557 10:65508138-65508160 GACGGTTTAGTGCTGTCACTTGG + Intergenic
1069519500 10:69107411-69107433 GATGGTTGAGCACTACCACCTGG - Intergenic
1069791071 10:71021351-71021373 GACAGTTGAGTGCTGCCACTTGG + Intergenic
1070201122 10:74207391-74207413 GCTGTTTCAGTCCTGCCACTTGG + Intronic
1071378158 10:85031657-85031679 CATGGTTGAGTACTTCCACTTGG - Intergenic
1071937456 10:90547553-90547575 GACGGTTGGGTTCTGTCACTTGG - Intergenic
1072209503 10:93233457-93233479 GACGGTTGACTGCTGCCACTTGG + Intergenic
1072343615 10:94480560-94480582 AATGATTGAGTGCTGCCACTTGG + Intronic
1072390938 10:94986408-94986430 GTTGGTTGAATTCTGCCTCTAGG + Intronic
1072914832 10:99531349-99531371 GAGGGTGGAGGGCTGCCACGCGG - Intergenic
1073141895 10:101253821-101253843 ACCGGTTGAGTGCAGCCACTGGG - Intergenic
1073557103 10:104464135-104464157 GATGGTTGAGTGCCGCCACTTGG - Intergenic
1073656885 10:105426009-105426031 GACAGTTGAGTGCTGCCACTTGG + Intergenic
1073854862 10:107662450-107662472 GATGGTTGAGTGCCCCCACTTGG - Intergenic
1074236544 10:111590276-111590298 GGTGGTTGAGTGGTGCCACTTGG + Intergenic
1074244711 10:111677096-111677118 GACAGTTGGGTGCTGTCACTTGG - Intergenic
1074590131 10:114804781-114804803 GTTAGTTAAGTGCTTCCACTTGG - Intergenic
1075099923 10:119499034-119499056 GGGGGTTGGGTGCTGCCACCAGG - Intergenic
1075662857 10:124210161-124210183 GATGGTTAAGTGCTGCCAGCTGG - Intergenic
1076122937 10:127950671-127950693 GACAGTTGAGTGCTGCCACTTGG - Intronic
1076927647 10:133500999-133501021 GATAGCTGAGTGCCACCACTTGG + Intergenic
1079902576 11:26205406-26205428 TATAGTTGAATTCTGCCACTAGG - Intergenic
1080720978 11:34848354-34848376 GATGGTTGAGAGTTACCACCTGG - Intergenic
1080976624 11:37350082-37350104 GACAGTTAAGTGCTGCCTCTTGG - Intergenic
1081065695 11:38536668-38536690 GATGGTTGAGCCCCGCCACTTGG + Intergenic
1081110229 11:39126612-39126634 GAAGGTTGAGTACTGCCACTCGG - Intergenic
1081520649 11:43877987-43878009 AATAATTAAGTGCTGCCACTTGG + Intergenic
1081608802 11:44546066-44546088 GGAAGTTGAGTGCTGCCACTTGG - Intergenic
1082671461 11:56041267-56041289 GAAGGCTGAGTGCTGCCACTTGG - Intergenic
1082999386 11:59277754-59277776 GATGGTTGAGTGCCACCACTTGG - Intergenic
1083010408 11:59391943-59391965 TCTGGCTGAGTGCTGCCTCTTGG - Intergenic
1083092905 11:60219320-60219342 GATGGCTGAGTGCTGCCATTTGG - Intronic
1083642428 11:64152785-64152807 GCTGGCTGAGTGCTGCCAACCGG - Intronic
1084104157 11:66969930-66969952 GATGGTTGATTGCTGCTACTTGG - Intergenic
1085202139 11:74708265-74708287 GGTGGGTGAGTGCTGCCAGATGG + Intronic
1085747340 11:79126454-79126476 GACAGTTGAGTGCCGCCACTTGG - Intronic
1085864887 11:80279453-80279475 GATGGTTGGGAGATGCCTCTTGG + Intergenic
1086278391 11:85158680-85158702 GGAGGTTGAGTGCTACCGCTTGG - Intronic
1086833888 11:91598620-91598642 GAAGGCTGAGTGCTGCCACTTGG - Intergenic
1087373823 11:97318973-97318995 GGTGGTTGAGTGCTGCCACTTGG - Intergenic
1087495067 11:98880816-98880838 GTTAGTCAAGTGCTGCCACTTGG + Intergenic
1087798917 11:102483037-102483059 GAAGGTTTAGAGCTGCCAGTAGG - Intronic
1088191913 11:107236288-107236310 GATGGTTGAGTGCCACCACTTGG + Intergenic
1088264916 11:107979764-107979786 GATGGTTGAGTGGTGCCACTCGG - Intergenic
1088407847 11:109500451-109500473 GAGAGTTGAGTGCCGCCATTTGG + Intergenic
1088449114 11:109963564-109963586 GACGGTTGAGGGCTGCCACTTGG - Intergenic
1089903382 11:122011826-122011848 GATAGTTAAGTGCTGCCACTTGG - Intergenic
1090209903 11:124911550-124911572 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1090221847 11:125033368-125033390 GATGGTTGAGTGCTGCCACTTGG + Intronic
1090314376 11:125772018-125772040 GATGATTAAGTGCTGACACCTGG + Intergenic
1091103382 11:132896443-132896465 GACGGTTGAGTGCCGTCACTTGG - Intronic
1092093038 12:5819846-5819868 GATGGTTGAGTGCTGCCACTTGG - Intronic
1092381103 12:7997752-7997774 GATGGTTGAGTGCCACCACTTGG - Intergenic
1093036063 12:14333553-14333575 GATGGTTGAGTGCCGCCACTTGG - Intergenic
1093049160 12:14486743-14486765 GACAGTTGAGTGCCACCACTTGG + Intronic
1093049899 12:14492744-14492766 GACAGTTGAGTGCCACCACTTGG + Intronic
1095525232 12:43117434-43117456 GGTGGTTGAGTGCCACAACTTGG + Intergenic
1095856458 12:46865453-46865475 GATGATTGAGTGTCACCACTTGG + Intergenic
1096053304 12:48629870-48629892 GGAGGTTGAGTGCTGCCACTTGG - Intergenic
1097554798 12:61123182-61123204 GATGGAGGAATGCTGCCCCTAGG + Intergenic
1097821632 12:64133988-64134010 GATGATTGAGTGTTGCCACTTGG + Intronic
1097843600 12:64344548-64344570 GACAGTTGAGTGCTGCCACTTGG + Intronic
1098119401 12:67220248-67220270 GATGATTCAGTGCTGCCACCTGG + Intergenic
1098672808 12:73252463-73252485 GACAGTTGAGTGCCACCACTTGG - Intergenic
1098730822 12:74035566-74035588 GATCGTTTAGTGCTCCCACTTGG - Intergenic
1098731317 12:74039271-74039293 GAAGGAGGAGTGCTGCCACCAGG + Intergenic
1098745514 12:74232778-74232800 GGTGGTTGAGTGCTGTCACTTGG - Intergenic
1098749607 12:74277707-74277729 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1098805217 12:75014293-75014315 GACAGTTGAGTGCTGCAACTTGG - Intergenic
1098816459 12:75171283-75171305 CATGGTTGAGGGCTGTCAATGGG - Intronic
1098832136 12:75375820-75375842 GACGGTTGAGTGCCACTACTTGG + Intronic
1099365700 12:81763666-81763688 GATGGTTGAATGCTGCCACTTGG - Intergenic
1099401349 12:82206493-82206515 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1099508201 12:83504096-83504118 GACAGTTGAGTGCCACCACTTGG - Intergenic
1099859627 12:88210408-88210430 GACAGTTGAGTGCCTCCACTTGG + Intergenic
1100241403 12:92713477-92713499 GATGGTTGAGTGCTGCCACCTGG + Intergenic
1100242225 12:92721293-92721315 CATTGTTGAGTGCTGACACATGG + Intergenic
1101139367 12:101779224-101779246 GTTCTTTGAGTTCTGCCACTGGG - Intronic
1101222412 12:102655202-102655224 GGTACTTGAGTGCTGCCACTTGG - Intergenic
1101263884 12:103064321-103064343 GATGGTTGAGTGCTGCCATTTGG - Intergenic
1101534916 12:105607892-105607914 GACAGTTGAGTGCCACCACTTGG + Intergenic
1101542846 12:105680877-105680899 GATGGTTGTGTGCCACCACTTGG - Intergenic
1101853537 12:108423560-108423582 GATGGGTAAGTGTTGCCACCTGG + Intergenic
1103035336 12:117651948-117651970 GACAGTTGAGTGCTGCCACTTGG - Intronic
1103396279 12:120609662-120609684 GACAGTTGAGTGCCGCCACTTGG - Intergenic
1106046442 13:26146348-26146370 GGTGGTTGGGTGCTGCCACTTGG + Intronic
1107598717 13:41990843-41990865 GATGGTTGAGGCCTGCAGCTGGG - Intergenic
1108904060 13:55448182-55448204 GACTGTTGAGTGCCACCACTTGG - Intergenic
1108914527 13:55590682-55590704 GATGGTTGAGTGATGCCACTTGG + Intergenic
1109292988 13:60498361-60498383 GATGGTTGAGTGCCACCACTTGG - Intronic
1109497384 13:63190600-63190622 TATGGTTAAGTGCTGTCACCTGG - Intergenic
1109516040 13:63443516-63443538 GATATTTGAGTGCTGCCACTTGG - Intergenic
1109652012 13:65339656-65339678 GAGGGATTAGTGCTGCCACGCGG + Intergenic
1109712907 13:66182682-66182704 GATGACTGAGTGCTGTCACATGG + Intergenic
1110376948 13:74804701-74804723 GGTGGTTCAGTGCCCCCACTTGG - Intergenic
1111016416 13:82387606-82387628 GATGGTTGAGTGCCACCACTTGG + Intergenic
1111039111 13:82721083-82721105 GATAGTTGAATGAGGCCACTTGG + Intergenic
1111432433 13:88161382-88161404 GGTGGCTGAGTACTGCCACCTGG + Intergenic
1111440856 13:88281347-88281369 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1113093585 13:106639550-106639572 GATGGTAGAGTATTTCCACTGGG + Intergenic
1113319949 13:109223463-109223485 GATGGTTAAGTGCCGCTACTTGG + Intergenic
1113853680 13:113432467-113432489 GCTAGCTGAGTGCTGCAACTGGG - Intronic
1113965863 13:114153483-114153505 GATGGTGGAGTGATGCCTCTAGG - Intergenic
1114390934 14:22308046-22308068 GTAGGGTGAGTGCTGCCTCTGGG - Intergenic
1114758503 14:25285644-25285666 GACAGTTGAATACTGCCACTTGG + Intergenic
1115059474 14:29172113-29172135 GATGGTTGAGTGCCACCACTTGG - Intergenic
1116058677 14:39895153-39895175 GACAGTTGAGTGCCTCCACTTGG - Intergenic
1116248933 14:42456491-42456513 GATGGTTGAATGCCACCATTTGG - Intergenic
1116414842 14:44667526-44667548 GATAGCTGAGTGCCTCCACTTGG - Intergenic
1116531679 14:45979987-45980009 GATGGTTGAGTGCCACCACTTGG + Intergenic
1117001343 14:51374502-51374524 GAAGGTTGAGGGCTGCCACTTGG - Intergenic
1117216589 14:53558308-53558330 GACAGTTGAGTCCTGCCACTTGG - Intergenic
1117596508 14:57331676-57331698 GACAGTTGAGTGCCACCACTTGG + Intergenic
1117633887 14:57722599-57722621 GACGGTTGAGTGCCACTACTTGG - Intronic
1118880998 14:69825803-69825825 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1118950800 14:70434869-70434891 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1119695325 14:76708913-76708935 CAAGGTTGGGTGCTACCACTTGG + Intergenic
1120082266 14:80229330-80229352 GATGGTTGAGTGCTGCCACTTGG + Intronic
1120231648 14:81847047-81847069 GACGGTTGAGTGCCGCCACTTGG + Intergenic
1120556228 14:85932227-85932249 GATGGTTGAGTGCCACCACTTGG + Intergenic
1121371140 14:93359506-93359528 GATTGTTGAGTGCTGCCACTTGG - Intronic
1202935533 14_KI270725v1_random:84133-84155 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1123818523 15:24003238-24003260 GAAGGTTGACAGCTGCCATTTGG + Intergenic
1123847180 15:24314561-24314583 GAAGGTTGACAGCTGCCACATGG + Intergenic
1123866178 15:24521628-24521650 GAAGGTTGACAGCTGCCACATGG + Intergenic
1123876891 15:24632528-24632550 GAAGGTTGATTGCTGTCACTTGG + Intergenic
1124620446 15:31270986-31271008 TCTGGTTAAGTGCTGCCAATGGG - Intergenic
1129961631 15:79691844-79691866 GATGGTTGAGTGCCACCACTTGG + Intergenic
1130735387 15:86542719-86542741 GGTGGTTAAGTGCTACCACTTGG - Intronic
1130867709 15:87946605-87946627 GATGGTTAGGAGCTGCCACCAGG - Intronic
1131658913 15:94492873-94492895 GAGGGAGGAATGCTGCCACTAGG + Intergenic
1134363032 16:13550470-13550492 TATGGTTAAGAGTTGCCACTTGG - Intergenic
1136059641 16:27717812-27717834 GTTGGTTGAGTGCTGCTCCTGGG - Intronic
1138868598 16:60852352-60852374 GATGGAGGAATGCTGCCACGAGG + Intergenic
1139975935 16:70810286-70810308 GATGGGTGAGTGCTGCCAGTAGG + Intronic
1140597649 16:76435425-76435447 GATGTTTGAGTGCCACCACTTGG + Intronic
1140862167 16:79027301-79027323 GATGGTGGAGTGGTGACATTTGG + Intronic
1141559790 16:84859824-84859846 GATGGTTGAGTGCTGCCACTTGG + Intronic
1142515744 17:427387-427409 GAAGGTGGTGTGCTGGCACTGGG + Intergenic
1142945845 17:3426410-3426432 AATGGTTGAGTGCTGCCACTTGG + Intergenic
1147649139 17:42051993-42052015 GAGGGCTGTGTGGTGCCACTCGG - Intronic
1148655032 17:49276882-49276904 GATGTTTCAGTGCTGCCACCTGG + Intergenic
1148805285 17:50260840-50260862 GGTGGTTGGGTGCTGGCCCTGGG - Intergenic
1149197418 17:54137747-54137769 GTTGGTTAAGTGCTGCCACCTGG - Intergenic
1149236241 17:54594031-54594053 GGTGGTTGAGTGCCACCACTTGG + Intergenic
1150898331 17:69239678-69239700 AATTGTTGAGTGCTGCCACCCGG + Intronic
1151037852 17:70821998-70822020 GACATTTGAGTGCTGCCACTTGG + Intergenic
1152987338 18:332711-332733 GAAGCTTGAGGGCTGCCACCAGG - Intronic
1153131516 18:1859511-1859533 GATGTTTGGATGCTGCCACTTGG + Intergenic
1153217942 18:2837396-2837418 GATGGTTGAGTGCCACTACTTGG + Intergenic
1154068231 18:11129304-11129326 GACAGTTGAGTGCTGCCACTTGG - Intronic
1154252980 18:12759385-12759407 GATGGCTAAGTGCTGCCACTTGG + Intergenic
1154505954 18:15041082-15041104 GATGGTTTAGTGCTGCCACTTGG - Intergenic
1155123083 18:22842578-22842600 GATAGTTAAGTGCTATCACTTGG - Intronic
1155337254 18:24777357-24777379 GGCAATTGAGTGCTGCCACTTGG + Intergenic
1156083803 18:33375155-33375177 GGTTATTGAGTTCTGCCACTAGG - Intronic
1156303632 18:35856946-35856968 GACAGTTGAGTGCTGCCACTTGG - Intergenic
1156537554 18:37878738-37878760 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1156998361 18:43495930-43495952 GATGGTTGAGTGCCACCACTTGG - Intergenic
1157612472 18:48966593-48966615 GTTAGTTGAGTGATGACACTTGG - Intergenic
1157845944 18:51004181-51004203 GATGGTTGAGTGCTGCCACTTGG - Intronic
1157871211 18:51231700-51231722 GACGGATGAGTGCTGCTACTTGG + Intergenic
1157941692 18:51935686-51935708 GATGGAATAGTGCTGCCATTAGG + Intergenic
1159287551 18:66373680-66373702 GATGGTTTAGGGCTGCCACTTGG - Intergenic
1159559318 18:69976953-69976975 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1159624826 18:70680505-70680527 GATGCTTCAGTGCAGTCACTTGG - Intergenic
1159738952 18:72140930-72140952 GATGGATGAGTGTAGACACTTGG - Intergenic
1164117543 19:22236900-22236922 GATGGTTGAGTGCCACCACTTGG + Intergenic
1164200247 19:23012180-23012202 GATGGTCGAGTGCCACCACTTGG + Intergenic
1164604152 19:29584219-29584241 ATTGGTTGAGTGCTGCCAGAAGG + Intergenic
1168254329 19:55157561-55157583 GATGGGTGAGTGATGCCCCAAGG - Exonic
1168539594 19:57199156-57199178 GATGGTTGAGTGCCACCACTTGG + Intronic
925499633 2:4488700-4488722 GATGGCTCAGTGCTGCCAGTTGG + Intergenic
926098097 2:10095635-10095657 GATGGAAGAATGCTGCCATTTGG - Intergenic
926603866 2:14876868-14876890 GATGATTATGTGCTACCACTTGG + Intergenic
926810629 2:16752470-16752492 GATGGTTGAGTGCTGCCACTTGG + Intergenic
926825825 2:16904144-16904166 TATGGTTGAGTGCCACCACTTGG + Intergenic
928396130 2:30944556-30944578 GTTGGTTGAGTGGTCCCATTCGG - Intronic
929270066 2:39962564-39962586 GTTGGTTGAGTGCTGCCACTTGG + Intergenic
929549986 2:42883943-42883965 GATGGCTGGGTGCCGCCACTTGG - Intergenic
929626045 2:43408150-43408172 GTTGGTTGATGGCTGCAACTTGG - Intronic
930128352 2:47822110-47822132 GCTGGATCAGTGCTTCCACTTGG + Intronic
930456500 2:51613556-51613578 GATGGTTGAGTGTTGCCACTTGG + Intergenic
930852399 2:55974909-55974931 GGGGGTTGAATGCTGCCACTTGG + Intergenic
930903125 2:56532505-56532527 GGTGGTTGATTGCTGCCACCTGG + Intergenic
930909922 2:56619072-56619094 GACGCTTGAGTGCTACCACTTGG - Intergenic
931579754 2:63759958-63759980 GATGGGTGATAGCTGTCACTGGG + Intronic
933265948 2:80180512-80180534 GACAGTTGAGTGCTGCCATTTGG + Intronic
934305679 2:91820147-91820169 GAGGGTTGAGTGCTACCACTTGG - Intergenic
934327577 2:92032595-92032617 GAGGGTTGAGTGCTACCACTTGG + Intergenic
934465964 2:94263174-94263196 GAGGGTTGAGTGCTACCACTTGG + Intergenic
935425333 2:102913114-102913136 GATAGTTGATTGCCACCACTTGG + Intergenic
935564552 2:104592053-104592075 AATGGTTGAGTGCCACCACTTGG + Intergenic
937246287 2:120496167-120496189 AGTGGTTGAGTGCCGACACTGGG + Intergenic
937800096 2:126072955-126072977 GATGGTTCAGTGCCTCCCCTTGG - Intergenic
937852796 2:126650505-126650527 GACTGTTTAGTGCTGCCACGTGG + Intergenic
939068843 2:137516069-137516091 GTTGGTTGAGTGCTGCCACTTGG - Intronic
939788910 2:146547866-146547888 GACAGTTGAGTGCCGCCACTTGG + Intergenic
940171557 2:150834511-150834533 GATGGTTGAGTGCTGCCACTTGG + Intergenic
940472320 2:154114894-154114916 GATGGTTCAGTGCCACCACTTGG + Intronic
940606151 2:155926147-155926169 GGTGGTTGAGTGCCACCACTTGG + Intergenic
940700805 2:157040510-157040532 GATGGTTGGGTCATGCAACTTGG - Intergenic
941330907 2:164176368-164176390 GATGGTTGATTGCTGCCACTTGG + Intergenic
941667767 2:168259391-168259413 GATGGTTGAGTGTCTCCACTTGG - Intergenic
943224036 2:185145297-185145319 GATGTTTCAGTCCTGCCATTTGG - Intergenic
943306099 2:186264517-186264539 GGTAGTTGAATGCTGCCACTTGG - Intergenic
943384259 2:187182665-187182687 GATGGTTGAGTGCTGCCACTTGG + Intergenic
943517835 2:188909028-188909050 GACTGTTGAGTGCTGCCACTTGG + Intergenic
944919985 2:204402777-204402799 GATGGTTAAGTGTTACCACCTGG + Intergenic
945448835 2:209970153-209970175 GAGAGTTGAGGGCTGCCAGTTGG + Intronic
945544643 2:211136384-211136406 GACAGTTGACTGCTGCCACTTGG - Intergenic
945726054 2:213473275-213473297 GATGGTTGAGTGTCGCCACTTGG + Intronic
945748930 2:213755920-213755942 GATGGTTAAATGCAGCCACAGGG - Intronic
945837376 2:214849041-214849063 GATAGTTAAGTGGTGCCACCTGG + Intergenic
946528104 2:220541763-220541785 GACGGTTGAGTGCCGCCACTTGG + Intergenic
946790696 2:223297964-223297986 GACAGTTGAATGCTGCCACTTGG - Intergenic
1169735961 20:8837868-8837890 GACGGTCGAGTGCTGCCACTTGG - Intronic
1169930574 20:10828389-10828411 GATGATTGATGGCTGCCACATGG - Intergenic
1171330291 20:24331454-24331476 GGTGGCTGAGTGCTGCCTCTTGG + Intergenic
1172132298 20:32664021-32664043 GATGGCTGAGTGCAGCAAGTGGG + Intergenic
1172635997 20:36410331-36410353 AATGGCTGAGGGCTGCCCCTGGG - Intronic
1173709374 20:45141032-45141054 GACAGTTGAGTGCTGCCACTTGG + Intergenic
1176596958 21:8706369-8706391 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1176791902 21:13327944-13327966 GATGGTTTAGTGCTGCCACTTGG + Intergenic
1176997919 21:15578438-15578460 GTTGTTTGAGTGCTGCCACTTGG - Intergenic
1177002855 21:15635333-15635355 GATGGCTGAGTGCTGCCACTTGG + Intergenic
1177363501 21:20104063-20104085 GACGGTTGAGTGGCTCCACTTGG - Intergenic
1177505846 21:22016309-22016331 GATAGTTGAGTGCTGTCACTTGG + Intergenic
1177912957 21:27054440-27054462 GATGGCTGAGTGCCGTCACTTGG - Intergenic
1177933924 21:27318711-27318733 GATGGTTGAGTACTGACACTTGG + Intergenic
1177991296 21:28038946-28038968 GATGGTTTAGTGCTGCCACTTGG + Intergenic
1178012402 21:28303131-28303153 GATGGCTGAGTGTTGCCACTTGG - Intergenic
1178060975 21:28852937-28852959 GATGGTTGAGTGCTGCCACCTGG + Intergenic
1178061820 21:28861235-28861257 GATAGTTGAGTGCCACCACTTGG - Intergenic
1178349395 21:31861554-31861576 TCTGGTAGAGTGCTGCCACCTGG - Intergenic
1178640996 21:34344734-34344756 AATGGTTGAGTGCTGATAGTGGG + Intergenic
1178764056 21:35432724-35432746 GGTGGTTGAGTGCTGCCACTTGG + Intronic
1179458444 21:41515905-41515927 GGCAGTTGAGTGCTTCCACTTGG + Intronic
1179575481 21:42305838-42305860 GATGCTGGAGTGCTGCGACAAGG - Intergenic
1180279881 22:10683811-10683833 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1180587099 22:16902347-16902369 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1180591376 22:16940165-16940187 GAGGGTTGAGTGCCACCACTTGG + Intergenic
1180615335 22:17122341-17122363 GAAGGTAGAGTGCTGCCTTTAGG + Intronic
1182965604 22:34518599-34518621 GATGATTGAGTGCTGCCACTTGG + Intergenic
1183336127 22:37247624-37247646 GATGGAGGAGTGAAGCCACTTGG + Intergenic
1184603808 22:45560183-45560205 GATGGTTGAGTGCTGTCACTTGG + Intronic
1184638988 22:45858941-45858963 GGTGGGTGAGGGCTGCTACTTGG + Intergenic
949125895 3:444946-444968 GATGATTGAGTGCCGCCACTTGG + Intergenic
949170271 3:988368-988390 GACAGTTGAGTGCTGCCACTTGG + Intergenic
949245639 3:1923117-1923139 GATGGTTGAGGGCTGCCAGTTGG - Intergenic
949417885 3:3832978-3833000 GACAGTTGAGTGCTGCCACTTGG + Intronic
949445380 3:4129254-4129276 GACAGTTGAGTGCTACCATTTGG - Intronic
949638551 3:6010740-6010762 GATAGTTGAGTGCTTCCAGTTGG - Intergenic
949751124 3:7353796-7353818 GGTGGTGGAGTGCCACCACTTGG - Intronic
950260834 3:11542653-11542675 GGTGGTTGAGAGCAGCTACTAGG - Intronic
950874587 3:16259330-16259352 CATGGCTGTGTGCAGCCACTAGG - Exonic
951384310 3:22025954-22025976 GATGGTTGGGTGCTGCCACTTGG - Intronic
953538363 3:43793153-43793175 GGTGGTGGAGAGCTGCCACTGGG - Intergenic
953897629 3:46814288-46814310 GATGGTTGAGTGCCACCACTTGG + Intergenic
954053883 3:48005909-48005931 GATGGTTGAGTGCTGCTACTTGG - Intronic
954360780 3:50121727-50121749 GATGATGGAATGCTGCCACCTGG - Intergenic
954511768 3:51131762-51131784 GACAGTTGAGTGCTGCCACCTGG + Intronic
955035354 3:55262304-55262326 GACGGTTGAGTGATGCCACTTGG - Intergenic
956459576 3:69457896-69457918 CATTGTTGAGAGCTGCCCCTGGG - Intronic
956509407 3:69978563-69978585 GACAGTTGAGTGCCACCACTTGG - Intergenic
957241942 3:77671090-77671112 GATAGTTGAATGCTGCCACCTGG - Intergenic
957247767 3:77735122-77735144 AATGGTTGAGTGCTGCCACTTGG + Intergenic
957754379 3:84467600-84467622 GATAGTTGAGTGCTGCCACTTGG - Intergenic
957934740 3:86927673-86927695 GATGGTTAAGTACTGCCACCTGG + Intergenic
958499606 3:94888329-94888351 GATGGTTGAGTGCTGCCACTTGG - Intergenic
958845759 3:99262316-99262338 GATGGTTGAGTGCTGCCGCTTGG + Intergenic
959163385 3:102745850-102745872 GCAGATTCAGTGCTGCCACTTGG + Intergenic
959204027 3:103282641-103282663 GACAGTTGAGTGCTGCCACTTGG + Intergenic
959377624 3:105604955-105604977 GATGGTTGAGTGCTGCCACTTGG + Intergenic
959746251 3:109779044-109779066 CATGGGTGAGTGCTACCACTTGG + Intergenic
959856124 3:111161273-111161295 GGTGGTTAAATGCTGCCACTTGG + Intronic
959997393 3:112694209-112694231 GACAGTTGAGTGCTGCCACTTGG - Intergenic
962558232 3:136578230-136578252 GATGGTTAAGTGTGGCCACTTGG - Intronic
963355896 3:144208635-144208657 CATGGTTGAATGCCGCCACTTGG + Intergenic
963453491 3:145515308-145515330 GATGGTTGAGTGCTGCCACTTGG - Intergenic
963566680 3:146939205-146939227 GATGGTTGAGTGCCACGACTTGG - Intergenic
963630074 3:147721434-147721456 GATGGCTGAGTGCTGCCACTTGG - Intergenic
963661156 3:148130347-148130369 GATGGTTGAGTGCCGCGACTTGG - Intergenic
963852773 3:150224671-150224693 GATGGTTCAGTGCCTCCACCTGG - Intergenic
964852024 3:161105178-161105200 GGCGGTTGAGTCCTGCCACTGGG - Intronic
964977434 3:162637574-162637596 GGTGGTTGAGTGCCACAACTTGG + Intergenic
965191053 3:165530349-165530371 GATGGTTGAGTATTGCCATTTGG + Intergenic
965226993 3:166002559-166002581 AAAGGTTGAGTGCCACCACTTGG + Intergenic
966445447 3:179996771-179996793 GTTGGTTGAAAGCTGCCACTTGG - Intronic
966608478 3:181845317-181845339 TATGGTTGAGCGCTCCCACAGGG + Intergenic
966763279 3:183435879-183435901 GATGACTGAGTGCTGCCACTTGG - Intergenic
966896785 3:184450997-184451019 GGCAGTGGAGTGCTGCCACTTGG + Intronic
967831535 3:193924195-193924217 GATGGTTGAGTGCTGCCACTTGG - Intergenic
968906639 4:3455847-3455869 GATGGTTGAGTGCCGCCACTTGG - Intergenic
969160951 4:5258548-5258570 GATGTTTGAGGGCTCACACTGGG - Intronic
970089419 4:12388139-12388161 GATGGTTGAGTGCCTCCTCGTGG + Intergenic
971002900 4:22342054-22342076 CATGGTTGAGTGCTGCCACTTGG - Intergenic
971101249 4:23468215-23468237 GACAGTTGAGTGCTGTCACTTGG + Intergenic
971817000 4:31503272-31503294 GATGATTGAGTGCTGCCACTTGG - Intergenic
971979523 4:33734653-33734675 GATGTTTGAGTGCCGCCACTTGG + Intergenic
972201523 4:36718937-36718959 GAAGGCTGAGTGCTGCCACTTGG + Intergenic
972883203 4:43449942-43449964 GATGGTAAAGTGATCCCACTTGG + Intergenic
973118208 4:46487253-46487275 CACAGTTGAGTGCTGCCACTTGG - Intergenic
973121243 4:46523030-46523052 GAGGGTTGAGTGCCACCACTTGG + Intergenic
973143268 4:46794668-46794690 GGCAGTTGAGTGCTACCACTTGG - Intronic
974262604 4:59544069-59544091 GATGGCTGAGTGCTGTCACTTGG + Intergenic
974289362 4:59910973-59910995 GACAGTTGAGTGCTGCCATTTGG - Intergenic
974458936 4:62163451-62163473 GATGGATGAGTGCCACCACTTGG - Intergenic
974479249 4:62422648-62422670 GATGGTTGAGTGCTATAACTTGG + Intergenic
974726851 4:65809674-65809696 GAGGGGTGAGTGCCACCACTTGG - Intergenic
974747144 4:66090716-66090738 GATGGTTGAGTGCCTCCGCCTGG + Intergenic
975024257 4:69529832-69529854 GACAATTGAGTGCTACCACTTGG - Intergenic
975733935 4:77363818-77363840 GATGGTTGAGTGCTGCCACTTGG + Intronic
975982853 4:80179064-80179086 GACAGTTGAGTGCTACCGCTTGG + Intergenic
976034417 4:80797554-80797576 GATGGTTGAGTGCCACCACTTGG + Intronic
977204460 4:94153829-94153851 GATAATTGAGTGCTACCACTTGG - Intergenic
977490317 4:97701849-97701871 GACAGTTGAGTGCCACCACTTGG + Intronic
977626830 4:99197113-99197135 AATGTTTGAGTGCCACCACTTGG + Intergenic
977701980 4:100031688-100031710 GATGGTTAAGTGCCATCACTTGG + Intergenic
977976934 4:103276894-103276916 GATAGCTGAGTGCTGTCACTTGG + Intergenic
978899308 4:113928633-113928655 GATGGTTGAGTGCCACCACTTGG + Intronic
978966622 4:114749150-114749172 GACAGTTGAGTGCTGCCACTTGG - Intergenic
979075488 4:116264610-116264632 GACGTTTGAGTGCTGCCACTTGG - Intergenic
979595935 4:122533942-122533964 AATGGTTGAGTGCTCCCACTTGG + Intergenic
979766796 4:124473009-124473031 GATGGTTGTTTGCCACCACTTGG - Intergenic
979888831 4:126064531-126064553 GATGTTTGAGTGCCTCCACTTGG + Intergenic
980386481 4:132092270-132092292 GACGATCGAGTGCTGCCACTAGG + Intergenic
980388147 4:132112902-132112924 GACTGGTGAGTGCTGCCACTTGG + Intergenic
980406124 4:132355592-132355614 GACAATTGAGTGCTACCACTTGG + Intergenic
980601931 4:135037680-135037702 GATGGTTGTGTGCTGCCACTAGG - Intergenic
980628434 4:135405831-135405853 GATGGTTGAGTGCCACCATTTGG - Intergenic
981570446 4:146145537-146145559 GATGGTTAATGGCTGCCACCTGG - Intergenic
981834617 4:149040673-149040695 GACACTTGAGTGCTGCCACTTGG - Intergenic
982466866 4:155742807-155742829 GGTGGTTGAGTTCTGCCACTTGG + Intergenic
982526969 4:156490610-156490632 GATGGTTGAGTGCCACCACTTGG - Intergenic
982847543 4:160272513-160272535 GATGACTGAGTGCTGCCACTTGG - Intergenic
983184823 4:164689775-164689797 GATGGTTGAGTACTACCAGTTGG - Intergenic
983359130 4:166705997-166706019 GATTGTTGAGTGCCACCACTTGG - Intergenic
983495088 4:168434584-168434606 AGTGATTAAGTGCTGCCACTTGG - Intronic
984061301 4:174991598-174991620 GATGGTTGAGTGCTGCCTTTTGG + Intergenic
986742681 5:10717706-10717728 GATGGTCGAGTGCTGCCACTTGG - Intronic
986938552 5:12920530-12920552 GATGGTTGAGTGCCACCACTTGG + Intergenic
986955765 5:13147927-13147949 GACAGTTAAGTGCTGCCACTTGG + Intergenic
986959598 5:13197410-13197432 GATGGTTGAGTGCCACCACTTGG - Intergenic
987152938 5:15059875-15059897 GATGGTTGAGTGCTACCACTTGG - Intergenic
987578590 5:19760128-19760150 GACAGATGAATGCTGCCACTTGG + Intronic
987621591 5:20343114-20343136 GATGGTTGAGTGCTGCCACTTGG - Intronic
987657352 5:20823436-20823458 GATGGTTGAGTGCTGCCACTTGG + Intergenic
987967117 5:24891672-24891694 CATCATTGAATGCTGCCACTTGG - Intergenic
987994998 5:25264881-25264903 GGAGGTTGGGTGCTGCCACTTGG - Intergenic
988080056 5:26403219-26403241 GACAGTTGAGTGCCACCACTTGG + Intergenic
988107535 5:26770727-26770749 GATGGTTGAGTGCCGCCACTTGG - Intergenic
988161041 5:27518668-27518690 GATGGTTTAGTGTCTCCACTTGG + Intergenic
988169420 5:27634608-27634630 GACGGTTGAGTGCTGCCATTTGG + Intergenic
988188552 5:27899455-27899477 GGTGGTTGAATGCTGCCACTTGG - Intergenic
988228551 5:28446357-28446379 GATGGGTGAGTGCTGCAACTTGG - Intergenic
988233518 5:28508872-28508894 GATGGTTGAGTGCCAGCACTTGG + Intergenic
988267725 5:28973154-28973176 CATGGTTGAGTGCTGCCACTTGG + Intergenic
988561891 5:32289086-32289108 GACAGTTGAGTGCCGCCACTTGG - Intronic
989045502 5:37269705-37269727 GACAGTTGAGTGCCACCACTTGG + Intergenic
989457884 5:41663565-41663587 GACAGTTGAGTGCCTCCACTTGG + Intergenic
989486614 5:41998170-41998192 GACGATTGAGTGCCACCACTTGG + Intergenic
990007651 5:50963002-50963024 TAGGGTTGAGTGCTGAGACTGGG - Intergenic
990781509 5:59369674-59369696 AATGTTGGAGTGTTGCCACTGGG + Intronic
990997776 5:61750265-61750287 AGTGGATGAATGCTGCCACTGGG + Intronic
991014054 5:61912702-61912724 GACGGTTGAGTGCTGTCACTTGG + Intergenic
991033310 5:62104110-62104132 GACTGTTGAGTGCTGCCACATGG - Intergenic
992110209 5:73485681-73485703 GGTGGTCGAGTGTTGCAACTTGG + Intergenic
992242636 5:74787652-74787674 GATGGTTGAGTGCTCCCACTTGG - Intronic
993412811 5:87593608-87593630 GATGGTTAACTGCTGCCACATGG + Intergenic
993791559 5:92217126-92217148 GATGGTTGAGTGCTGCCACTTGG - Intergenic
994291613 5:98033765-98033787 GAGGGTTGAGTGCCACCACTTGG + Intergenic
994493294 5:100476138-100476160 GATGGTTGAAGGCAGCGACTAGG + Intergenic
994539334 5:101075117-101075139 TTTGGTTGAGTGCAGTCACTTGG - Intergenic
994836900 5:104866361-104866383 GACAGTTGAGTGCTACCACTTGG - Intergenic
994958231 5:106562538-106562560 GATGGTTGAGTGCCTACACTTGG - Intergenic
995269793 5:110207258-110207280 GACAGTTGAGTGCTGCCACTTGG + Intergenic
995776527 5:115729470-115729492 GACAGTTGAGTGCTGCCACTTGG + Intergenic
996825324 5:127676034-127676056 GATTGTTGAGTGCTGCCACTTGG - Intergenic
998896103 5:146801902-146801924 CATGGTTAAGTGGGGCCACTTGG - Intronic
999216380 5:149939042-149939064 GAAGGTTGCATTCTGCCACTGGG + Intronic
999351153 5:150873060-150873082 GATGGTTGAGTGCCGCCACTTGG - Intronic
999534925 5:152505621-152505643 GATGTTGAAGTGCTGCCACCTGG + Intergenic
1000121460 5:158201858-158201880 GGTTGTTGATTGCTGCCACCAGG + Intergenic
1000223477 5:159236072-159236094 CATGGTTGAGTGCCTCAACTTGG + Intergenic
1000416733 5:160992129-160992151 GATAGTTTAGTGCTACCACTTGG - Intergenic
1000730562 5:164829191-164829213 GATGGTTGAGTGCTGCCACCTGG - Intergenic
1003412763 6:5880092-5880114 GATGGCTGAATGCTGCTACTTGG + Intergenic
1003423881 6:5983558-5983580 GATGATTGAGGGCAGCCACATGG + Intergenic
1003758374 6:9148288-9148310 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1004298378 6:14434906-14434928 GGTGGTTAAGAGCTGCCACATGG - Intergenic
1004824530 6:19405024-19405046 GATGGTTGAGTGCCACCACTTGG + Intergenic
1005622697 6:27634775-27634797 GATAGTTGAGTGCTGCCACTTGG + Intergenic
1006001266 6:30966971-30966993 GATGTTTGAGTGCTACCACTTGG - Intergenic
1006062110 6:31431365-31431387 GATGGTTGAATGCTGCCACTTGG - Intergenic
1006173460 6:32108455-32108477 GATGGCTGAGAGATGCCTCTGGG - Intronic
1006347293 6:33493049-33493071 GTTGGTTAAGTGCTTCAACTTGG - Intergenic
1006811660 6:36824217-36824239 GTTGGTTGAGTGCGGCCTTTTGG - Intronic
1006985836 6:38175031-38175053 GAGGGTAGTGAGCTGCCACTAGG + Exonic
1008400053 6:51053694-51053716 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1009308404 6:62120505-62120527 GACAGTTGAGTGCTGCCACTTGG - Intronic
1009390344 6:63136886-63136908 GATAGTTGAGTGCCTCCACTTGG + Intergenic
1009787214 6:68355283-68355305 GACTGTTGAGTGCTGCCACTTGG + Intergenic
1009806262 6:68605157-68605179 GACTGTTGAGTGACGCCACTTGG - Intergenic
1010323340 6:74538697-74538719 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1010325561 6:74558390-74558412 GATGGCTGAGTGCCGCCACGTGG + Intergenic
1010552195 6:77236919-77236941 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1010818388 6:80386610-80386632 GATGGTTGAGTGCCACCACTTGG - Intergenic
1011068860 6:83359903-83359925 GAAGGTTGAGTGTGGCCACTTGG - Intronic
1011634911 6:89362701-89362723 GGTGGTTGAGAGAGGCCACTCGG + Intergenic
1012225895 6:96703061-96703083 GGTGATTGAGTGCTGCCACTTGG - Intergenic
1012344350 6:98168540-98168562 GATGGTTGATTGCTACCACTTGG - Intergenic
1012820563 6:104081131-104081153 GATGGTCGAGTGCCAACACTTGG - Intergenic
1013065987 6:106684872-106684894 GATGGTTAAGTACTCCCACTTGG - Intergenic
1014075238 6:117227880-117227902 GATGGCTAAGTGCTACCACCTGG + Intergenic
1014416768 6:121193585-121193607 GATGGTTGAGTGCCACCACTTGG - Intronic
1014456073 6:121636351-121636373 GATTGCTGAGTGCTGTCACTTGG + Intergenic
1014534437 6:122598417-122598439 CACAGTTGAGTGCTGCCACTTGG + Intronic
1014751058 6:125256655-125256677 CATGTTTGAGTTTTGCCACTTGG - Intronic
1014829042 6:126079889-126079911 GGTGGATCAGTGCTGCTACTTGG - Intergenic
1014895467 6:126894777-126894799 GGTGGTTGAGTGCTGCCACTTGG - Intergenic
1015467165 6:133560025-133560047 GATGGTTGAGTTCCACCAGTTGG + Intergenic
1015475500 6:133655527-133655549 GATGGTTGAGTTCTGCCACTTGG - Intergenic
1016144054 6:140647604-140647626 GATGGCTGAGTTCCACCACTTGG - Intergenic
1016147533 6:140694510-140694532 GACAGTTGAGTGCTGCCACTTGG + Intergenic
1016219967 6:141655825-141655847 GATGGTTTAGTGCCACCACTTGG - Intergenic
1016419843 6:143872471-143872493 GATGGCTGAGTGCTGCCACTTGG + Intronic
1016576483 6:145574388-145574410 GACAGTTGAGTGCTGCCACTTGG + Intronic
1017044353 6:150333566-150333588 GGTGATTGAGTGTTGCCATTTGG + Intergenic
1017228059 6:152042881-152042903 GATGCTTGAGTGCCACCACTTGG + Intronic
1017451991 6:154562920-154562942 GGTGGTTGAGTGCTGCCCCTTGG - Intergenic
1017977350 6:159369857-159369879 GATGTTTCAGTGCTGACACTTGG + Intergenic
1018107568 6:160503596-160503618 GATGGGTCAGTGTTGCCACTTGG + Intergenic
1018123169 6:160657025-160657047 GATGGTTCAGTGCCAACACTTGG + Intronic
1018535239 6:164812270-164812292 GATGATTGAGTGCCACCACTTGG + Intergenic
1019002739 6:168769121-168769143 AACAGTTGAGTGCTACCACTCGG - Intergenic
1019002757 6:168769292-168769314 GATAGTTGAGTGCCACCATTTGG - Intergenic
1019040560 6:169100661-169100683 GATGGTTGAGTGCCACCACTTGG - Intergenic
1019747561 7:2709226-2709248 GATGGTTCAGTGCTGCAAGGTGG + Exonic
1020396476 7:7723744-7723766 GACGGCTGAGTGCCACCACTTGG - Intronic
1020710096 7:11595821-11595843 GATGGTTGAGTGCCGCCACTTGG - Intronic
1020751502 7:12147040-12147062 GATGGTCAAATGCTGCCACTTGG + Intergenic
1022078653 7:26998536-26998558 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1022104914 7:27190638-27190660 GAAGCTTCAGTGCTGCCTCTGGG - Intergenic
1023328916 7:39091992-39092014 GAAGGTTCAGTTCTGCTACTGGG + Intronic
1024040118 7:45546494-45546516 GACAGTTGAGTGCCACCACTTGG + Intergenic
1024086430 7:45895352-45895374 GTTGGTTGAGTGCCTCCACTTGG + Intergenic
1024112385 7:46160425-46160447 GATAATGGAGTGCTGACACTTGG - Intergenic
1024744428 7:52390002-52390024 GAAGGAGGAGTGCTGCCACCAGG + Intergenic
1024783005 7:52874273-52874295 TGCAGTTGAGTGCTGCCACTTGG + Intergenic
1024884581 7:54126437-54126459 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1024958495 7:54950879-54950901 GAAGGTTGAGTGCTGCCATTTGG + Intergenic
1025156122 7:56607069-56607091 GATGGCTGAGTGTCACCACTTGG + Intergenic
1025761938 7:64403713-64403735 GATGGCTGAGTGCCACCACTTGG - Intergenic
1026560495 7:71444388-71444410 GATGGTTTAGTGTGGCCACATGG - Intronic
1027406994 7:77872548-77872570 GATGGTTGATTGCTGCCACTTGG + Intronic
1027685575 7:81276205-81276227 GACAATTGAGTGCTGCCACTTGG - Intergenic
1027799584 7:82734656-82734678 GGTGGTTGAGTGCCACCACTTGG - Intergenic
1028043633 7:86089668-86089690 GAAGATTGAGTGCCACCACTTGG - Intergenic
1028141509 7:87280183-87280205 GATGGTTTAGTTTTGCCACTTGG - Intergenic
1028237588 7:88381054-88381076 GACAGTTGAGTGCTGCCACTTGG - Intergenic
1028904876 7:96141599-96141621 GATGGGTGAGAACTACCACTAGG + Intronic
1030368317 7:108671162-108671184 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1030457686 7:109794834-109794856 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1031474679 7:122207132-122207154 GATGGTTGAGTACCTCCACTTGG + Intergenic
1031779356 7:125942036-125942058 GATGGTTGAGTGTCACCACTTGG + Intergenic
1032153347 7:129448730-129448752 GATGGTCGAGTGCTTCCACTTGG + Intronic
1032923654 7:136577590-136577612 GACAGTTGACTGCTGCCACCTGG + Intergenic
1033075972 7:138250911-138250933 GATGGCTGAGTGCTGCCACTTGG - Intergenic
1034169827 7:149054356-149054378 GACAATTGAGTGCTGCCACTTGG - Intergenic
1036203546 8:6788773-6788795 GTTGGTTGAGTATGGCCACTGGG - Intergenic
1037665582 8:20966872-20966894 GTTGGTTAAGGGCTGCCCCTCGG - Intergenic
1038640420 8:29320176-29320198 GATGGCTCTGTGCTGCCACCCGG + Intergenic
1038648441 8:29380677-29380699 GATGGTGGGGGGCTCCCACTTGG + Intergenic
1040901911 8:52426406-52426428 GATGGGAGAGTGCTGGCCCTTGG + Intronic
1040916377 8:52569631-52569653 GACAGTTGAGTGTTGCCACTTGG + Intergenic
1041153223 8:54957591-54957613 GGTGGTTAAGTTCTGCCACCAGG + Intergenic
1041934246 8:63319073-63319095 GATGATTGAGTGCCACCAATTGG - Intergenic
1042001292 8:64125761-64125783 GATGGTTGAGTGCCATAACTTGG + Intergenic
1042068018 8:64900187-64900209 GGTAGCTGAGTGCTGCTACTTGG - Intergenic
1043258228 8:78161746-78161768 GATGGCGGAATGCTGCCACCAGG + Intergenic
1043260203 8:78185945-78185967 GACGGTGGAGTGCTGCCACTTGG + Intergenic
1044150565 8:88771271-88771293 GATAGTTGAGTGCCACCACTTGG - Intergenic
1044192378 8:89334140-89334162 GGCAGTTCAGTGCTGCCACTTGG + Intergenic
1044344749 8:91092203-91092225 TCTTGTTGAGTGCTGCCACAAGG - Intergenic
1044487391 8:92768923-92768945 GACGGTTGAGTGCCGCCACTTGG + Intergenic
1044632926 8:94296836-94296858 GAGGGAGGAATGCTGCCACTAGG - Intergenic
1044633657 8:94301580-94301602 GACACTTGAGTGCTGCCACTTGG + Intergenic
1045221535 8:100204887-100204909 GATGGTTGAGTGCCACCACTTGG - Intronic
1045826397 8:106403352-106403374 GACAGTTGAGTGCTGCCACTTGG + Intronic
1046064134 8:109176495-109176517 GATAGCTGAGTGCTGCTACTTGG + Intergenic
1046128903 8:109943398-109943420 GATAGTCGAGTGCCACCACTAGG + Intergenic
1046718784 8:117595951-117595973 GGTGATTGAGTGATGCCACCTGG - Intergenic
1048084079 8:131158642-131158664 GATGGTTGAGTGCCACCACTTGG + Intergenic
1050447283 9:5738924-5738946 GATAGTTGAGTGCCGTCACTTGG + Intronic
1050482428 9:6100816-6100838 GACGGTTGGGTGCTGCCACTTGG - Intergenic
1050916963 9:11148391-11148413 TATGCTTAAGTGCTGCCATTTGG - Intergenic
1051966178 9:22832443-22832465 GACAGTTGAGTGCTGCCACTTGG - Intergenic
1052577061 9:30304182-30304204 GGTGGTTGAGTGCTGCCACTTGG - Intergenic
1053696019 9:40639951-40639973 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1054307266 9:63439169-63439191 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1054405997 9:64763161-64763183 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1054439623 9:65248648-65248670 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1054490784 9:65773291-65773313 GAGGGTTGAGTGCTACCACTTGG - Intergenic
1056314474 9:85374744-85374766 GATGGTTGAGTGCCACCACTTGG + Intergenic
1056741717 9:89261985-89262007 GATGTGTGAGGGCTGACACTGGG + Intergenic
1057236899 9:93368277-93368299 GGTGGTTGAGTGCATCCACTTGG + Intergenic
1057316686 9:93973634-93973656 GACGGTTGAGTGCCGCCACTTGG - Intergenic
1057648031 9:96895198-96895220 GGTGATTAAATGCTGCCACTTGG - Intergenic
1058259480 9:102811467-102811489 GATGGTTGAGTGCCGCCACTTGG + Intergenic
1059384370 9:113952563-113952585 GATGGTTGAGTGATGGGCCTTGG + Intronic
1060804906 9:126569152-126569174 GAGGGAGGAGTGCTTCCACTGGG - Intergenic
1060805372 9:126572475-126572497 GGCAGTTGAGTGCTGCCATTCGG + Intergenic
1202778466 9_KI270717v1_random:13564-13586 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1187114508 X:16335383-16335405 GTTGGTTGAGGGCTGCTTCTAGG + Intergenic
1187604649 X:20870271-20870293 AACGGTTGAGTGCTACCACTTGG - Intergenic
1189561491 X:42195635-42195657 ACTGGTTGAGAGCTGCCTCTGGG + Intergenic
1189665801 X:43353670-43353692 GGTGATTGAGTTCTGCCTCTTGG + Intergenic
1190538149 X:51449411-51449433 GGTGGTTGAGTGCTGTCAGTTGG - Intergenic
1190809736 X:53871626-53871648 CGTGGTTGAGTGCTGCCACTTGG - Intergenic
1191226511 X:58049887-58049909 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1191759131 X:64628127-64628149 GACAGTTGTGTGCTGCCACTTGG - Intergenic
1191769729 X:64741895-64741917 GATGGTTGAGTGCCACCACTTGG + Intergenic
1191832904 X:65434093-65434115 GGCAGTTGAGTGCTGCTACTTGG + Intronic
1191941475 X:66485655-66485677 GAAGGTTGAGTGCTGCCACTTGG + Intergenic
1191946131 X:66537213-66537235 GACTGTTGAGTGCTGCCACTTGG - Intergenic
1191988413 X:67006431-67006453 GATGGTTGAGTGCCACCACTTGG + Intergenic
1192297950 X:69869785-69869807 CATGGTTGAGTGCTGTCACGTGG + Intronic
1192789571 X:74368180-74368202 GATGATTTAGTTCTGCCATTTGG + Intergenic
1193053195 X:77123386-77123408 GATGATTGACTGCTGCCACTTGG - Intergenic
1193297558 X:79850903-79850925 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1193433133 X:81437214-81437236 GATAGTTGAGTGTCGTCACTTGG + Intergenic
1193543232 X:82796308-82796330 GGTGGTTGAGTGCCACCACTTGG - Intergenic
1193822056 X:86177189-86177211 GATAGTTATGTGCTGCCACAGGG - Intronic
1193832714 X:86308327-86308349 GACAGTCGAGTGCTGCCACTTGG - Intronic
1193877054 X:86873516-86873538 GATGATTGAGTGCCGCCACTTGG - Intergenic
1193904371 X:87224766-87224788 GATGATTGAGTGCCACCACTTGG - Intergenic
1193915044 X:87353731-87353753 GATGGATGAGTGCCACCACTTGG + Intergenic
1194032228 X:88831654-88831676 GATGGCTGAGTGCTACCACTTGG + Intergenic
1194210049 X:91060567-91060589 GACAGTTGAGTGCTGCCACTTGG - Intergenic
1194343085 X:92729302-92729324 GACGTTTGAGTGTTGCCACTTGG - Intergenic
1194343521 X:92732656-92732678 GATGGAGGAATGCTGCCACCAGG + Intergenic
1194385862 X:93254672-93254694 GGCAGTTGAGTGCTGCCACTTGG + Intergenic
1194443334 X:93959303-93959325 GATGATTGAGTGCCACCACTTGG - Intergenic
1194520885 X:94917638-94917660 GACGGTTGAGTGCTGCCACTTGG - Intergenic
1194604164 X:95960285-95960307 GAGGGATGAATGCTGCCACCAGG - Intergenic
1194604622 X:95963777-95963799 GATGGTTAAGTGCCACCACTCGG + Intergenic
1194833709 X:98656999-98657021 GATGGTTGAGTGCTGCCACTTGG - Intergenic
1194849489 X:98853967-98853989 GATGGCTGAGTGCTGCCACTTGG + Intergenic
1195749082 X:108146473-108146495 GATGGTTGAGTGCTGCCACTTGG + Intronic
1195809895 X:108817624-108817646 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1196275590 X:113762312-113762334 GATTGTTGAGTGCCACTACTTGG - Intergenic
1197002056 X:121451155-121451177 TATGGTTGAGTGCTGCTGCTTGG - Intergenic
1197084424 X:122455298-122455320 GACGGTTGAGTGCTGCCACTTGG + Intergenic
1197097238 X:122611043-122611065 GATGGTTGAGTGCCATCACTTGG - Intergenic
1197177817 X:123503686-123503708 GGTGGTGGAGTGCTATCACTTGG - Intergenic
1197372264 X:125639658-125639680 GATGGTTAAGTGCTGCCACTTGG + Intergenic
1197409454 X:126097629-126097651 GAGAGTTGAGTGCTGCCACTTGG + Intergenic
1197425979 X:126297407-126297429 GACAGTTGAGTGCTGTCACTTGG + Intergenic
1197477594 X:126943124-126943146 GATGGTTGAGTGCTGCCACTTGG + Intergenic
1197554493 X:127937339-127937361 GATGGTTAAGTGCTGCCACTTGG + Intergenic
1197591625 X:128417545-128417567 GATGGTTGAGTGGCACCACTTGG - Intergenic
1198307086 X:135394032-135394054 GAGGGAGGAATGCTGCCACTAGG + Intergenic
1198701055 X:139398492-139398514 GACAGTTGAGTGCCGTCACTTGG - Intergenic
1198783276 X:140259598-140259620 GGTGGTTGAGTGCCACCACTTGG + Intergenic
1199024150 X:142917917-142917939 GACAGTTGAGTGCTGCAACTTGG - Intergenic
1199310641 X:146316061-146316083 GATGGTTGAGTGCCACCACATGG + Intergenic
1199627315 X:149752392-149752414 GGCGGTTTAGTGCTGCCACTTGG + Intergenic
1200651445 Y:5845968-5845990 GACGTTTGAGTGCTGCCACTTGG - Intergenic
1200651876 Y:5849321-5849343 GATGGAGGAATGCTGCCACCAGG + Intergenic
1200973288 Y:9179345-9179367 GATGGTTGAGTACTGCCACTTGG + Intergenic
1201193778 Y:11471863-11471885 GAGGGTTGAGTGCTACCACTTGG + Intergenic
1201798226 Y:17924906-17924928 GATGGTCGAGTGTTGCCACTTGG - Intergenic
1201803327 Y:17981051-17981073 GATGGTCGAGTGTTGCCACTTGG + Intergenic
1202137788 Y:21685167-21685189 GATGGTTGAGTACTGCCACTTGG - Intergenic
1202192169 Y:22256767-22256789 GAGGTTTGAGTGGTGCCAATAGG + Intergenic
1202259336 Y:22953740-22953762 GCTGCTTGAGTCCTGCCACATGG + Intergenic
1202341299 Y:23871670-23871692 GATGGTTGAGTGCTGCTGCTTGG + Intergenic
1202359550 Y:24093597-24093619 GATGGTCGAGTGTTGCCACTTGG - Intergenic
1202412322 Y:24587484-24587506 GCTGCTTGAGTCCTGCCACATGG + Intergenic
1202458458 Y:25082586-25082608 GCTGCTTGAGTCCTGCCACATGG - Intergenic
1202511228 Y:25576517-25576539 GATGGTCGAGTGTTGCCACTTGG + Intergenic
1202529467 Y:25798416-25798438 GATGGTTGAGTGCTGCTGCTTGG - Intergenic