ID: 1003758379

View in Genome Browser
Species Human (GRCh38)
Location 6:9148306-9148328
Sequence TACACCCACCTGGCCTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 2, 1: 33, 2: 47, 3: 110, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003758379_1003758382 0 Left 1003758379 6:9148306-9148328 CCATCAAAGGCCAGGTGGGTGTA 0: 2
1: 33
2: 47
3: 110
4: 193
Right 1003758382 6:9148329-9148351 ACTACCGTAATGGACAGCAGAGG No data
1003758379_1003758381 -10 Left 1003758379 6:9148306-9148328 CCATCAAAGGCCAGGTGGGTGTA 0: 2
1: 33
2: 47
3: 110
4: 193
Right 1003758381 6:9148319-9148341 GGTGGGTGTAACTACCGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003758379 Original CRISPR TACACCCACCTGGCCTTTGA TGG (reversed) Intergenic
900798835 1:4725499-4725521 CACACCCACCTCCCCTTCGAGGG + Intronic
901444285 1:9298047-9298069 CACACTCACCTTGCCTTGGATGG - Intronic
905298270 1:36968537-36968559 TACCTCCACCTGCCCTTTCAAGG + Intronic
905353837 1:37367032-37367054 TATGCCCACCTTGCCTTTGATGG - Intergenic
906879456 1:49574721-49574743 TATGCCCACCTTGCCTTTGATGG - Intronic
907597112 1:55730335-55730357 TAAGCCCACCTTGCCTTTGATGG - Intergenic
907780111 1:57559085-57559107 TAAACCCAGCTTGCCTTTGATGG - Intronic
908616472 1:65928468-65928490 TACGCCCACCTTGCCTTTGAAGG + Intronic
909032864 1:70562063-70562085 TATGCCCACCTTGCCTTTAATGG - Intergenic
909810774 1:79929809-79929831 TACGTCCACCTTGCCTTTGATGG - Intergenic
910037396 1:82804665-82804687 TATACCCACCATGCCTTTGATGG + Intergenic
910587979 1:88899983-88900005 TACACCCACCTTGCCTTTGACGG - Intergenic
910639202 1:89441716-89441738 TACACCCACCTTGCCTTTGACGG + Intergenic
910739863 1:90503367-90503389 CTCACCCACCTGCCCTTTCAAGG + Intergenic
910790189 1:91042685-91042707 TACGCCCTCCTTGCCTTTGATGG - Intergenic
911109340 1:94165950-94165972 TACGCCCACCTTGCCTTTGATGG + Intronic
911980234 1:104557912-104557934 TATGCCCACCTTGCCTTTGACGG - Intergenic
911982119 1:104581026-104581048 TACACCTACCTTGCCTTACATGG + Intergenic
912944047 1:114069940-114069962 TACACCCACCTTGCCTTTTATGG + Intergenic
914349234 1:146825976-146825998 GACACGCACCTGGCCTGTGGTGG - Intergenic
915196522 1:154193937-154193959 TACAAGCTCCTGGCCTTTGCTGG + Intronic
915850430 1:159315940-159315962 AACAACTACCTGGCCATTGAAGG + Intergenic
916354649 1:163891181-163891203 TCCACCCACCTTGCTTTTGATGG + Intergenic
916728598 1:167546024-167546046 TAAACCCCCCTTGCCTTAGAAGG + Intronic
918774280 1:188609007-188609029 TACACTCACCTTGTTTTTGATGG - Intergenic
918918448 1:190673587-190673609 TACACCCACCTTGCCTTTGATGG + Intergenic
919124886 1:193381896-193381918 TACACCCACCTTGCTTTTGATGG + Intergenic
919230244 1:194764306-194764328 TATGTCCACCTTGCCTTTGATGG + Intergenic
919241572 1:194922746-194922768 TACACCCACCTTGCCTTTGATGG - Intergenic
920197193 1:204236611-204236633 TACACCCACCTTGCCTTTGATGG - Intronic
922847378 1:228697779-228697801 TTTGCCCACCTGGCCTTTGGTGG - Intergenic
923464458 1:234235826-234235848 TACACACACCGGGCCCTTGCAGG - Intronic
1064517885 10:16169986-16170008 TTCACCAACCTTACCTTTGATGG + Intergenic
1065188568 10:23191806-23191828 TGCACCCACCTGGTCCCTGAGGG + Intergenic
1066167266 10:32801005-32801027 TATGCCCACCTTGCCTTTGATGG + Intronic
1066543497 10:36474715-36474737 TACACCCACCTTGCCTTTGATGG - Intergenic
1066957569 10:42187651-42187673 TACGCTCACCGTGCCTTTGAGGG - Intergenic
1067125826 10:43514638-43514660 CACGCCCACCTTGCCTTTGATGG + Intergenic
1067332921 10:45338463-45338485 TATGCCCACCTTGCCTTTGATGG - Intergenic
1068225579 10:54103353-54103375 TACACCCACCTTGCCTTTGATGG + Intronic
1068446978 10:57136841-57136863 TACACCCACTTTGCTTTTGATGG - Intergenic
1069192552 10:65508120-65508142 TATGCCCACCTTGCCTTTGACGG + Intergenic
1071267318 10:83975755-83975777 TACGCCCACCTTGCCTTTGACGG + Intergenic
1071937463 10:90547571-90547593 TATGCCCACCTTGCCTTTGACGG - Intergenic
1072209498 10:93233439-93233461 TACACCCACCTTGCCTTTGACGG + Intergenic
1072759142 10:98041523-98041545 TATACCCACCTAGTCTTTGGAGG + Intergenic
1073557108 10:104464153-104464175 TATGCCCACCTTGCCTTTGATGG - Intergenic
1073854868 10:107662468-107662490 TACACCCCCTTTTCCTTTGATGG - Intergenic
1075777381 10:124997509-124997531 CACCCCAACCTGGCATTTGAAGG + Intronic
1077260360 11:1615497-1615519 GACACCCACATGTCCCTTGATGG + Intergenic
1081065690 11:38536650-38536672 TATGCCCACCTTGCCTTTGATGG + Intergenic
1082671465 11:56041285-56041307 TATGCCTACCTTGCCTTTGAAGG - Intergenic
1082999391 11:59277772-59277794 TACACCCACCTTGCCTTTGATGG - Intergenic
1085684309 11:78607923-78607945 CACTCCCACCTTGCCTTTGGTGG - Intergenic
1087373828 11:97318991-97319013 TACACCCACCTTGCCTTTGGTGG - Intergenic
1088191909 11:107236270-107236292 TATGCCCACCTTGTCTTTGATGG + Intergenic
1088449120 11:109963582-109963604 TATGCCCACCTTGCTTTTGACGG - Intergenic
1089524533 11:119088295-119088317 TGCACCCACCTGGCTCTTGCGGG - Exonic
1090541607 11:127712190-127712212 CATACCCACCTGGCTTTTGGTGG + Intergenic
1090644768 11:128758548-128758570 GACTCCTACCTGGCCTCTGAGGG - Intronic
1090651633 11:128811506-128811528 TTCACCCAACTGGAATTTGATGG + Exonic
1090894615 11:130959923-130959945 TACAGCCAACTGATCTTTGATGG - Intergenic
1091051507 11:132376975-132376997 TACACCCACCTTGTCTTTGACGG - Intergenic
1091543229 12:1481856-1481878 TACACCCTCCTGGCATGTGTAGG + Intronic
1091989290 12:4941618-4941640 TACATTCTCCTGGCCTTCGATGG - Intergenic
1092093043 12:5819864-5819886 TACACCCACCTTGCCTTTGATGG - Intronic
1092381106 12:7997770-7997792 TACACCTACCTTGTCTTTGATGG - Intergenic
1093036068 12:14333571-14333593 TATGCCCACCTTGCCTTTGATGG - Intergenic
1094362496 12:29644946-29644968 GACACCCACCTGGCCTGGGGAGG - Intronic
1094650247 12:32369274-32369296 TCCAGCCACCTGGCCTCTGATGG + Intronic
1094669928 12:32560117-32560139 TGCAACCACTTGGCCTTTCAGGG - Intronic
1095132165 12:38556400-38556422 CACACCCACCTTGCCTTTAGTGG + Intergenic
1095844702 12:46732255-46732277 TACACCCACCTTACCTTTGAAGG + Intergenic
1096600545 12:52725494-52725516 TTCACTCACCTGGCCCTTGATGG - Intergenic
1098749611 12:74277725-74277747 TACACCCACCTTGCTTTTGATGG - Intergenic
1098832132 12:75375802-75375824 TATGCCCACCTTGTCTTTGACGG + Intronic
1099365705 12:81763684-81763706 CAGGCCCACCTTGCCTTTGATGG - Intergenic
1099401345 12:82206475-82206497 TATGCCCATCTTGCCTTTGATGG + Intergenic
1100049989 12:90436163-90436185 TATGCCCACCTTGCCTTTGATGG - Intergenic
1100083087 12:90876463-90876485 TATGCCCATCTTGCCTTTGATGG - Intergenic
1100241398 12:92713459-92713481 TACACCCACCTTGCCTTTGATGG + Intergenic
1101263887 12:103064339-103064361 TACAACCACCTTGGCTTTGATGG - Intergenic
1101542851 12:105680895-105680917 TACGCCCACCTTGCCTTTGATGG - Intergenic
1102730450 12:115104229-115104251 GACACCCGCCTGGCCTTTCCCGG - Intergenic
1104224498 12:126818641-126818663 TCCACCCTCCTGGCCCTTGCTGG + Intergenic
1106741451 13:32647566-32647588 CAATCCCACCTGGCCTTTAATGG + Intronic
1107509477 13:41068665-41068687 TCTACCCATCTGCCCTTTGAAGG - Exonic
1108914524 13:55590664-55590686 TACGGCCACCTTGCTTTTGATGG + Intergenic
1109582828 13:64364371-64364393 TATGCCCACCTTGCCTTTGATGG - Intergenic
1110376953 13:74804719-74804741 TATGCCCACCTTGCCTTTGGTGG - Intergenic
1110932686 13:81242429-81242451 TGCATCCACCTTTCCTTTGAAGG + Intergenic
1111016412 13:82387588-82387610 TACGTCCACCTTGCCTTTGATGG + Intergenic
1111432428 13:88161364-88161386 TATACCCACCTTGCCTTAGGTGG + Intergenic
1112250163 13:97772001-97772023 TATGTCCACCTTGCCTTTGACGG + Intergenic
1112558784 13:100493322-100493344 TCCACCCAACAGGCCTTTGAAGG - Intronic
1113319944 13:109223445-109223467 TATGCCCACCTTACCTTTGATGG + Intergenic
1115059479 14:29172131-29172153 TACACCCACCTTGCCTTTGATGG - Intergenic
1115840459 14:37463461-37463483 TACAACCAACTGATCTTTGACGG + Intronic
1116531674 14:45979969-45979991 TATGCCCACCTTGCCTTTGATGG + Intergenic
1117001350 14:51374520-51374542 TATGCCCACCTTGCCTTTGAAGG - Intergenic
1117633891 14:57722617-57722639 TATGCCTACCTTGCCTTTGACGG - Intronic
1118880993 14:69825785-69825807 TATGCCCACCTAGCCTTTGATGG + Intergenic
1119107802 14:71940608-71940630 TATGCTCACCTTGCCTTTGATGG + Intronic
1120082263 14:80229312-80229334 TACATCCACTTTGCCTTTGATGG + Intronic
1120556223 14:85932209-85932231 TATGCCCACCTTGCCTTTGATGG + Intergenic
1202935528 14_KI270725v1_random:84115-84137 TACACCCACCATGCCTTTGAGGG + Intergenic
1123399273 15:19968308-19968330 TAAAGCCACCTGGCTGTTGATGG + Intergenic
1123818519 15:24003220-24003242 TATGCCCACCTTGACTTTGAAGG + Intergenic
1124883367 15:33662058-33662080 TCCACCCACCCTGCCTTTGTTGG + Intronic
1127964190 15:63911809-63911831 AACACCCACCTGCCTTGTGAGGG + Intronic
1128535990 15:68491033-68491055 CACAGCCACCTGGCTTATGAGGG + Intergenic
1129961625 15:79691826-79691848 TACGCCCACCTTCCCTTTGATGG + Intergenic
1132590944 16:726233-726255 TGCACCCTCCTGGCCTTTGGGGG + Intronic
1133334248 16:4996447-4996469 TGCACCCACCTTGCCTTTGTGGG - Exonic
1135061934 16:19278515-19278537 CACGCCCATCTTGCCTTTGATGG + Intergenic
1135876348 16:26203907-26203929 TACACCTAACTGCCTTTTGATGG - Intergenic
1137704048 16:50521628-50521650 TCCACCCACCTTGCCTCTGGAGG + Intergenic
1139711946 16:68782604-68782626 TAAAGCCACCTGTGCTTTGAGGG + Intronic
1139984802 16:70889578-70889600 GACACGCACCTGGCCTGTGGTGG + Exonic
1144621197 17:16819596-16819618 TCCACCCACCTGGCCTCTCAGGG + Intergenic
1146850694 17:36219257-36219279 TATGCCCACCTTGCCTTTCATGG - Intronic
1147573179 17:41583889-41583911 TCCACCCACCTGGCCTCTCAGGG + Exonic
1149466865 17:56886790-56886812 TACACACACCTGCATTTTGAGGG - Intergenic
1152467004 17:80472135-80472157 CACACCCACATGGCCCTTGGGGG - Intronic
1153217937 18:2837378-2837400 TATTCCCACCTTGCCTTTGATGG + Intergenic
1154252975 18:12759367-12759389 TATGCCCACCTTGCCTTTGATGG + Intergenic
1155089125 18:22489032-22489054 GACTCCCTCCTGGCCTTTGCTGG - Intergenic
1156192279 18:34733483-34733505 TATGCCCACCGTGCCTTTGATGG + Intronic
1156537559 18:37878756-37878778 TATGCCCACCTTGCCTTTGATGG - Intergenic
1156990518 18:43402470-43402492 TAAGCACACCTTGCCTTTGATGG + Intergenic
1156998366 18:43495948-43495970 TACACCCACCTTGCCTTTGATGG - Intergenic
1157845949 18:51004199-51004221 CATGCCCACCTTGCCTTTGATGG - Intronic
1157871206 18:51231682-51231704 TATGCCCACCTTGCCTTTGACGG + Intergenic
1159287558 18:66373698-66373720 TATGCCCACCTTGCCTTTGATGG - Intergenic
1164097350 19:22023447-22023469 TATGCCCACCTTGCCTTTGATGG + Intergenic
1164117538 19:22236882-22236904 TATGCCCACCTTGCCTTTGATGG + Intergenic
1164200242 19:23012162-23012184 TATGCCCACCTTGCCTTTGATGG + Intergenic
1166344620 19:42157406-42157428 GAGACCCATGTGGCCTTTGAGGG - Intronic
1167133661 19:47603834-47603856 TACACACACCTGACCTCTTAGGG - Intergenic
1168168273 19:54569952-54569974 CAAACCCACCTTGCCTTTGGTGG - Intergenic
1168539590 19:57199138-57199160 TATGCCTACCTTGCCTTTGATGG + Intronic
925165751 2:1714548-1714570 TGTCCCCACCTGGCCTTTCAGGG - Intronic
925196768 2:1932067-1932089 TACACTCCCATGGCCATTGATGG + Intronic
925499629 2:4488682-4488704 TATGCCCACGTTGCCTTTGATGG + Intergenic
926825820 2:16904126-16904148 TATGCCCACCTTGCCTTTTATGG + Intergenic
927210502 2:20636186-20636208 GCCACCCACCTGCCCTTTGGTGG - Intronic
928106791 2:28475696-28475718 TACAGCCACCTGGTCTTTCCTGG + Intronic
929549992 2:42883961-42883983 TACACCCACCTTGCATTTGATGG - Intergenic
930456495 2:51613538-51613560 TATGCCCACCTTACCTTTGATGG + Intergenic
933269954 2:80222651-80222673 TACACCCACCTGGCTTCCTAGGG - Intronic
934305684 2:91820165-91820187 TACGCCCACCGTGCCTTTGAGGG - Intergenic
934327572 2:92032577-92032599 TACGCCCACCGTGCCTTTGAGGG + Intergenic
934465959 2:94263156-94263178 TACACCCACCGTGCCTTTGAGGG + Intergenic
936440737 2:112550263-112550285 GACAGCCACCTGGCCTCTGTTGG + Intronic
937785424 2:125889488-125889510 TATGCCCACCTTGCCTTTGACGG + Intergenic
939068848 2:137516087-137516109 TACACCCACCTTACCTTTGTTGG - Intronic
940606146 2:155926129-155926151 TACACCCACCTTGCCTTTGGTGG + Intergenic
941330903 2:164176350-164176372 TATGACCACCTTGCCTTTGATGG + Intergenic
941667772 2:168259409-168259431 TATGCCCACCTTGCCTTTGATGG - Intergenic
943384255 2:187182647-187182669 TACACCCACCTTGCATTTGATGG + Intergenic
943447126 2:188000877-188000899 TACAACCAACTTGTCTTTGAAGG + Intergenic
944629733 2:201612329-201612351 TCCACCCACCTGGCCTCCCAAGG - Intronic
945342298 2:208671147-208671169 GTCACCCACCTGGCCTCTGCAGG - Intronic
945641929 2:212442051-212442073 CATGCCCACCTTGCCTTTGATGG - Intronic
946528097 2:220541745-220541767 TACACCCCCCTTGCCTTTGACGG + Intergenic
948611576 2:239170942-239170964 GAAATCCACCAGGCCTTTGAAGG + Intronic
1169592898 20:7164420-7164442 TCCACCCACGTGGCCTTGCAGGG - Intergenic
1173303992 20:41830680-41830702 CACACTCACCTGGACTTTTATGG - Intergenic
1176058844 20:63163169-63163191 AAGCCCCACCTGGCCTGTGAGGG + Intergenic
1176596953 21:8706351-8706373 TACACCCACCGTGCCTTTGAGGG + Intergenic
1177002851 21:15635315-15635337 TACGCCCACCTTGGCTTTGATGG + Intergenic
1177193013 21:17872648-17872670 TACATCCATCTTGCCTTTGGTGG + Intergenic
1177363507 21:20104081-20104103 TACACCCACCTTGCCTTTGACGG - Intergenic
1177933919 21:27318693-27318715 TACACCCACCTTGCCTTTGATGG + Intergenic
1177991291 21:28038928-28038950 TATGCCCACCTTGCCTTTGATGG + Intergenic
1178012406 21:28303149-28303171 TATGCCCACCTTGCTTTTGATGG - Intergenic
1178060970 21:28852919-28852941 TACACCCACCTTGCCTTTGATGG + Intergenic
1178764052 21:35432706-35432728 TACACCCACCTTGTCTTTGGTGG + Intronic
1179272155 21:39859923-39859945 TGCACCCACCTTGCTTTTGATGG + Intergenic
1179931083 21:44571428-44571450 AACACCCACCTGATCTTAGAGGG - Intronic
1180158040 21:45987506-45987528 CACACTCACCTGGCATTCGAAGG - Exonic
1180279876 22:10683793-10683815 TACACCCACCATGCCTTTGAGGG + Intergenic
1180587094 22:16902329-16902351 TATGCCCACCGTGCCTTTGAGGG + Intergenic
1181467698 22:23118930-23118952 TGCACCCATCTGGCCTTTGTGGG - Intronic
1181756561 22:25028651-25028673 TCCACACTGCTGGCCTTTGAGGG - Exonic
1184603803 22:45560165-45560187 TACACCCACCTTGCCTTTGATGG + Intronic
1185185783 22:49398840-49398862 GACACCCATCTGGCCTGTGCGGG - Intergenic
949245646 3:1923135-1923157 TATGCCCACCTTGCCTTTGATGG - Intergenic
950542388 3:13620279-13620301 TCCACTCACCTTGCCCTTGAGGG + Intronic
951384317 3:22025972-22025994 TATGCCCACCTTGCCTTTGATGG - Intronic
951970986 3:28443635-28443657 TATGCCCACCTTGCCTTTAATGG + Intronic
953897624 3:46814270-46814292 TATGCCCACCTTGCCTTTGATGG + Intergenic
953911224 3:46893996-46894018 GACCCCCACCTGGCCTCTGCAGG - Exonic
953950648 3:47187084-47187106 TATATCCACCTGGCTTTTAATGG + Intergenic
954053888 3:48005927-48005949 TACGCCCACCTTGCCTTTGATGG - Intronic
954250326 3:49362393-49362415 TAAAACAACCTGGCCTGTGAAGG + Intronic
958769837 3:98413017-98413039 TACAACCATCTGATCTTTGACGG + Intergenic
959100400 3:102003131-102003153 CACACTCACCTTGCCTTTGGTGG + Intergenic
959377621 3:105604937-105604959 TACACTCACCTTGCCTTTGATGG + Intergenic
959410452 3:106014962-106014984 TACACCCTCCATTCCTTTGATGG + Intergenic
959746245 3:109779026-109779048 TACACCCACCTTGCCTTTCATGG + Intergenic
960273598 3:115701256-115701278 TACACCAAACTGGCATTTCAGGG - Intronic
963102876 3:141622932-141622954 TGCACCCACTTGGGCTTTGGGGG + Intergenic
963289068 3:143468367-143468389 TATACCCAGCTGGTTTTTGATGG - Intronic
963355891 3:144208617-144208639 TACGCCCACCTTGCCTTTCATGG + Intergenic
963453495 3:145515326-145515348 TATGTCCACCTTGCCTTTGATGG - Intergenic
963630079 3:147721452-147721474 TACACCCACCTTGCCTTTGATGG - Intergenic
963661161 3:148130365-148130387 TACACCCTCCTTGCCTTTGATGG - Intergenic
963852777 3:150224689-150224711 TACTTCCACCTTGCCTCTGATGG - Intergenic
965216462 3:165870451-165870473 TACAGCCAACTGATCTTTGATGG - Intergenic
965251714 3:166351412-166351434 TATGCCCACCTTGACTTTGATGG + Intergenic
966445452 3:179996789-179996811 TACGCCCACCTTGCCTTTGTTGG - Intronic
968903652 4:3442264-3442286 AGCACCCACCTGCCCTGTGAGGG - Intronic
968906644 4:3455865-3455887 TGTGCCCACCTTGCCTTTGATGG - Intergenic
969084060 4:4642050-4642072 GGCACCCAGCCGGCCTTTGAAGG - Intergenic
969550782 4:7865742-7865764 TACACCCAGCTGGCACGTGAGGG + Intronic
970089415 4:12388121-12388143 TACACCTACCTTGCCTTTGATGG + Intergenic
970145747 4:13033953-13033975 TCCAACTACCTGGCCTCTGAAGG - Intergenic
970816342 4:20160701-20160723 CACATCCACCTTGCCTTTGTTGG - Intergenic
971328897 4:25666024-25666046 CACAGCCAGCTGGCCTTGGATGG + Intronic
972095283 4:35340910-35340932 TACACCCACCTTGTCTTTGATGG - Intergenic
972201518 4:36718919-36718941 TACGCCCACCTTGCCTGTGAAGG + Intergenic
972883198 4:43449924-43449946 TATGCCCACCTTGCCTTTGATGG + Intergenic
973102715 4:46293000-46293022 TCCACCCACCTTGCCTTTGAGGG - Intronic
973121239 4:46523012-46523034 TATGCCCACTTTGCCTTTGAGGG + Intergenic
974479245 4:62422630-62422652 TATACCCACCTTTGCTTTGATGG + Intergenic
974564572 4:63566546-63566568 TACACCCACCTTGCCTTTGATGG - Intergenic
974644843 4:64676547-64676569 TACACCCACCTTGCTTTTGGTGG + Intergenic
974731039 4:65866715-65866737 TACAGCTACCAGGCCCTTGAAGG + Intergenic
974747140 4:66090698-66090720 TATGCCCACATTGCCTTTGATGG + Intergenic
974808164 4:66909253-66909275 TAAACCCACCTTGCATTTCAGGG + Intergenic
975733931 4:77363800-77363822 TATGTCCACCTTGCCTTTGATGG + Intronic
976989217 4:91343949-91343971 TACACTGATATGGCCTTTGAAGG + Intronic
977701975 4:100031670-100031692 TATGCCCACCTTGCCTTTGATGG + Intergenic
978899303 4:113928615-113928637 TACACCCACCTTGCCTTTGATGG + Intronic
979017942 4:115458665-115458687 TACGCCCACCTTGCCTTTAACGG + Intergenic
979898626 4:126190805-126190827 TATACCCACCTGGCCTTTGATGG + Intergenic
981797543 4:148614171-148614193 TACATCTACCTTGCCTCTGATGG + Intergenic
983184828 4:164689793-164689815 TATGCCCACCTTGCCTTTGATGG - Intergenic
986742686 5:10717724-10717746 TGCACCCACCTTGCCTTTGATGG - Intronic
986938549 5:12920512-12920534 TACACCCAACTTGTCTTTGATGG + Intergenic
986959603 5:13197428-13197450 TATGCCCACCTTTCCTTTGATGG - Intergenic
987152943 5:15059893-15059915 TACACCCACCTTGCCTTTGATGG - Intergenic
987504172 5:18748086-18748108 TACACCCATCTTGCCTTTGATGG - Intergenic
987657348 5:20823418-20823440 TATGCCCATCTTGCCTTTGATGG + Intergenic
988161036 5:27518650-27518672 TGTACCCACCTTGCCTTTGATGG + Intergenic
988169415 5:27634590-27634612 TACGCCCACCTTGCCTTTGACGG + Intergenic
988188557 5:27899473-27899495 TATGCCCACCTTGCCTTTGGTGG - Intergenic
988233513 5:28508854-28508876 TACACCCACCTTGCCTTTGATGG + Intergenic
988766198 5:34380530-34380552 TATGCCCATCTTGCCTTTGATGG - Intergenic
989097600 5:37795561-37795583 TATGCCCACCTTGCCTTTGATGG - Intergenic
991014050 5:61912684-61912706 TACGACCACCTTGCCTTTGACGG + Intergenic
992168459 5:74077945-74077967 TACATTTACCTGGGCTTTGAAGG - Intergenic
993202353 5:84831610-84831632 TACACCCTCATTCCCTTTGATGG - Intergenic
993319603 5:86456819-86456841 TACACTCACCATGCCTTTGATGG - Intergenic
993412808 5:87593590-87593612 TACTCTCACCTTGCCTTTGATGG + Intergenic
993791564 5:92217144-92217166 TATACCCACCTTGCCTTTGATGG - Intergenic
994291608 5:98033747-98033769 TATGCCCACCTTGCCTTTGAGGG + Intergenic
994958235 5:106562556-106562578 TAGGCCTACCTTGCCTTTGATGG - Intergenic
994984648 5:106917497-106917519 TATGCCCACCTTGCCTTTGATGG + Intergenic
995427971 5:112045542-112045564 TACACCCACCTTGCCTTTGAAGG + Intergenic
996908917 5:128633800-128633822 TATGCCCAACTTGCCTTTGATGG + Intronic
998564165 5:143201292-143201314 TACACCCATCTGGACTCTGAGGG + Intronic
998635994 5:143955113-143955135 TATAACAACCAGGCCTTTGAAGG - Intergenic
999351158 5:150873078-150873100 TATGCCCACCTTGCCTTTGATGG - Intronic
1000223473 5:159236054-159236076 TACATCCACCTTGCCTTTCATGG + Intergenic
1003067288 6:2914474-2914496 TACAGCCAGCTGGTCTCTGAGGG - Intergenic
1003758379 6:9148306-9148328 TACACCCACCTGGCCTTTGATGG - Intergenic
1004824527 6:19405006-19405028 TACGTCCACCTTGTCTTTGATGG + Intergenic
1006062113 6:31431383-31431405 TACACTCACCTTGCCTTTGATGG - Intergenic
1008400058 6:51053712-51053734 TATGCCCACCTTGCCTTTGATGG - Intergenic
1010108228 6:72192694-72192716 TATGCCCACCTTGCCTTTGATGG + Intronic
1010325556 6:74558372-74558394 TATGCCCACCTTGCCTTTGATGG + Intergenic
1010580957 6:77595516-77595538 TAGGCCCACCTTGCCTTTGATGG + Intergenic
1010818392 6:80386628-80386650 TATGCCCACATTGCCTTTGATGG - Intergenic
1010929948 6:81789737-81789759 TACAATTACTTGGCCTTTGAGGG + Intergenic
1011068866 6:83359921-83359943 TCCACCCACCTTGCGTTTGAAGG - Intronic
1012033202 6:94099269-94099291 CACGCCCACCTTGCCTTTGGTGG - Intergenic
1012344355 6:98168558-98168580 TACGCCCACCTTGCCTTTGATGG - Intergenic
1012363186 6:98408404-98408426 CACACCCACCTTGCCGTTGGTGG + Intergenic
1012820568 6:104081149-104081171 TATGCCCACCTTGCCTTTGATGG - Intergenic
1014416773 6:121193603-121193625 TAGGCCCACCTTGCCTTTGATGG - Intronic
1015467160 6:133560007-133560029 TATGCCCACCTTGCCTTTGATGG + Intergenic
1015475503 6:133655545-133655567 TACGCCTACCTTGCATTTGATGG - Intergenic
1016144059 6:140647622-140647644 TATGCCCACCTTGCCTTTGATGG - Intergenic
1016219972 6:141655843-141655865 TACTCCCACCTTGCCTTTGATGG - Intergenic
1016419839 6:143872453-143872475 TACATCCACCTTGCCTTTGATGG + Intronic
1016912397 6:149212030-149212052 AAGACCCACCTGGCCCATGAAGG + Intergenic
1017919348 6:158857691-158857713 GACACCTGCCTGGCCCTTGAGGG - Intergenic
1018123164 6:160657007-160657029 TATGCCCACCTTGCCTTTGATGG + Intronic
1019040565 6:169100679-169100701 TACACCCACCTTGCCTTTGATGG - Intergenic
1020396480 7:7723762-7723784 TATGCCTACCTTGCCTTTGACGG - Intronic
1020710101 7:11595839-11595861 TATGCCCGCCTTGCCTTTGATGG - Intronic
1021102940 7:16604790-16604812 AAAACCCACCTGGCCAGTGATGG + Exonic
1022326895 7:29340721-29340743 AACACACTCCTGGCCTGTGAGGG - Intronic
1022385377 7:29893835-29893857 TACACCCACCTGGCCCCTGAAGG + Intronic
1023907706 7:44533903-44533925 AACTCCCTGCTGGCCTTTGAGGG - Intronic
1024492072 7:49996881-49996903 TATGCCCACCTTGCCTTTGGTGG + Intronic
1024884576 7:54126419-54126441 TATGCCCACCTTTCCTTTGATGG + Intergenic
1024958490 7:54950861-54950883 TATGCCCACCTTGCCTTTGAAGG + Intergenic
1025156116 7:56607051-56607073 TACACCCACCCTGCCTTTGATGG + Intergenic
1025761943 7:64403731-64403753 TACACCCACCTTGCCTTTGATGG - Intergenic
1026239509 7:68560179-68560201 TATATCAACCTGGCCTCTGATGG + Intergenic
1027406989 7:77872530-77872552 CACACCCACCTTGCCTTTGATGG + Intronic
1028141515 7:87280201-87280223 TATCCCCACCTTGCCTTTGATGG - Intergenic
1030083840 7:105800356-105800378 TACACCAAGCTGGACCTTGAAGG - Intronic
1030368321 7:108671180-108671202 TATGTCCACCTTGCCTTTGATGG - Intergenic
1030457681 7:109794816-109794838 TACTCCCACCTGGCCTATGATGG + Intergenic
1031236616 7:119186234-119186256 TACACCCACCTTGCCTTTGGTGG - Intergenic
1031676329 7:124616565-124616587 TACGCCCACCTTTCCTTTGATGG - Intergenic
1031779352 7:125942018-125942040 TACGTCCACCTTGCCTTTGATGG + Intergenic
1032130256 7:129222143-129222165 TACAGCCACCTGGCATGTGTTGG - Intergenic
1032153344 7:129448712-129448734 TATGCTCACCTTGCCTTTGATGG + Intronic
1033075977 7:138250929-138250951 TACGCCCACCTTGCCTTTGATGG - Intergenic
1035024055 7:155815080-155815102 TAGAGCCACCTGGCCTCTGGAGG - Intergenic
1039173021 8:34770290-34770312 TACACCCTGCTGTCCTTTCAAGG - Intergenic
1039178776 8:34839825-34839847 TACAGCCACCTTGACTTGGATGG - Intergenic
1039626820 8:39062615-39062637 TATGCCCACCTTGCCTTTGGTGG + Intronic
1042001287 8:64125743-64125765 TATGCCCACCTTGCCTTTGATGG + Intergenic
1042152544 8:65803899-65803921 TACACACACCTTGCCTCTGCTGG - Intronic
1043257776 8:78157587-78157609 TATGCCCACCATGCCTTTGACGG - Intergenic
1044133531 8:88556902-88556924 CACAGCCACCTTGCCTTTGATGG - Intergenic
1044286197 8:90414228-90414250 TATGCCCACCTTGCCTTTGATGG + Intergenic
1044487388 8:92768905-92768927 TACGTCCACCTTGCTTTTGACGG + Intergenic
1045221538 8:100204905-100204927 TACGTCCACCTTGCTTTTGATGG - Intronic
1046197340 8:110882468-110882490 TACACTCACCTTGCCTTTCATGG - Intergenic
1047984358 8:130217105-130217127 TCCACTCACATGGCCTTGGATGG - Intronic
1049014604 8:139910750-139910772 CACGCCCACCTGGCCTGAGAAGG - Intronic
1049268541 8:141682207-141682229 AACACACACCCGGCCTGTGAGGG - Intergenic
1049391371 8:142373311-142373333 ATCACCCAGCTGTCCTTTGAGGG - Intronic
1050482434 9:6100834-6100856 TACACCCAACTTGCCTTTGACGG - Intergenic
1052227375 9:26106590-26106612 TACACCCACCTTGCCTTTGAAGG - Intronic
1053696014 9:40639933-40639955 TATGCCCACCGTGCCTTTGAGGG + Intergenic
1054307261 9:63439151-63439173 TATGCCCACCGTGCCTTTGAGGG + Intergenic
1054405992 9:64763143-64763165 TACGCCCACCGTGCCTTTGAGGG + Intergenic
1054439618 9:65248630-65248652 TACGCCCACCGTGCCTTTGAGGG + Intergenic
1054490789 9:65773309-65773331 TACGCCCACCGTGCCTTTGAGGG - Intergenic
1056314469 9:85374726-85374748 TATGCCCACCTTGCCTTTGATGG + Intergenic
1057316691 9:93973652-93973674 TATGCCCACCTTGCCTTTGACGG - Intergenic
1058259477 9:102811449-102811471 TATATCCACCTTGCTTTTGATGG + Intergenic
1060619180 9:125047477-125047499 TCCAACCACCTGGGATTTGATGG - Intronic
1060823873 9:126676509-126676531 CGTGCCCACCTGGCCTTTGAAGG + Intronic
1061670850 9:132187350-132187372 TAAACCAACCTGGCATTTTAGGG - Intronic
1061975628 9:134067052-134067074 TACACCCACATGGCCCTGGTGGG - Intronic
1202778461 9_KI270717v1_random:13546-13568 TATGCCCACCGTGCCTTTGAGGG + Intergenic
1186470011 X:9813861-9813883 TACGCACACCTTGCCTTTGACGG + Intronic
1187290472 X:17948468-17948490 TAAACCCACCTGGCCTAGGTTGG - Intergenic
1188661217 X:32761194-32761216 TAAACCCACCTGGCCTATCCAGG + Intronic
1189221528 X:39376307-39376329 TCCAGCCACCTGTCCTTTGGGGG - Intergenic
1191226515 X:58049905-58049927 TATGCCCACTTTGCCTTTGATGG - Intergenic
1191719476 X:64217434-64217456 TACACCCATCTTGCCTTTGACGG + Intergenic
1192661789 X:73049538-73049560 TACACCCACCTTGCCTCTGAAGG + Intergenic
1193297563 X:79850921-79850943 TATGCCCACCTTGCCTTTGATGG - Intergenic
1193915039 X:87353713-87353735 TATGCCCACCTTGCCTTTGATGG + Intergenic
1193979023 X:88158416-88158438 TGTACCCAACTTGCCTTTGACGG - Intergenic
1194032223 X:88831636-88831658 TACACCCACCTTGCCTTTGATGG + Intergenic
1194179818 X:90697730-90697752 TATGCCCATCTGGCCTTTGATGG + Intergenic
1194520889 X:94917656-94917678 TATGCCTACCTTGCCTTTGACGG - Intergenic
1194604617 X:95963759-95963781 TATGCCCACCTCACCTTTGATGG + Intergenic
1195749077 X:108146455-108146477 TATGCCCACCTTGCCTTTGATGG + Intronic
1195782598 X:108481648-108481670 TACACCCACCTTGCCTTTGGCGG + Intronic
1197084419 X:122455280-122455302 TGTGCCCACCTTGCCTTTGACGG + Intergenic
1197097242 X:122611061-122611083 TATATCCACCTTGCCTTTGATGG - Intergenic
1197167368 X:123392518-123392540 TCAACCCACATGGGCTTTGAAGG - Intronic
1197245339 X:124161089-124161111 TACACCCACCTGGCCTTTGACGG + Intronic
1197348342 X:125350971-125350993 TGGACCCACCTGGGTTTTGAGGG + Intergenic
1197372259 X:125639640-125639662 TACACCCACCTTGCCTTTGATGG + Intergenic
1197477589 X:126943106-126943128 TATGCCCACCTTGCCTTTGATGG + Intergenic
1197591631 X:128417563-128417585 TATGCCCACCTTGCCTTTGATGG - Intergenic
1198554258 X:137776073-137776095 TTCACCCACCTGGCCAATCAAGG + Intergenic
1198816765 X:140599764-140599786 TACAACCAGCTGGCCTTCAAGGG - Intergenic
1198933782 X:141886073-141886095 TATACCCGCCTTGCCTTTGATGG - Intronic
1199310636 X:146316043-146316065 TTCACCCACCTTGCCTTTGATGG + Intergenic
1199627310 X:149752374-149752396 TATGCCCACCTTGCCTTTGGCGG + Intergenic
1200328053 X:155263826-155263848 TCCACCAACCTGCCCTTTGGTGG - Intronic
1200362350 X:155621967-155621989 ACCACCCACCTGCCCTTTGCGGG - Intronic
1200521065 Y:4210264-4210286 TACACCCACCTTGCCTTTGATGG - Intergenic
1200526474 Y:4279899-4279921 TATGCCCATCTGGCCTTTGATGG + Intergenic
1200973284 Y:9179327-9179349 TACATCCACCTTGCCTTTGATGG + Intergenic
1201193773 Y:11471845-11471867 TACGCCCACCGTGCCTTTGAGGG + Intergenic
1201798231 Y:17924924-17924946 TACACCCACCTTGCCTCTGATGG - Intergenic
1201803322 Y:17981033-17981055 TACACCCACCTTGCCTCTGATGG + Intergenic
1202137793 Y:21685185-21685207 TACACCCACCTTGCCTTTGATGG - Intergenic
1202359555 Y:24093615-24093637 TACACCCACCTTGCCTTTGATGG - Intergenic
1202511223 Y:25576499-25576521 TACACCCACCTTGCCTTTGATGG + Intergenic