ID: 1003758381

View in Genome Browser
Species Human (GRCh38)
Location 6:9148319-9148341
Sequence GGTGGGTGTAACTACCGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003758374_1003758381 8 Left 1003758374 6:9148288-9148310 CCAAGTGGCAGCACTCAACCATC 0: 45
1: 62
2: 148
3: 143
4: 244
Right 1003758381 6:9148319-9148341 GGTGGGTGTAACTACCGTAATGG No data
1003758379_1003758381 -10 Left 1003758379 6:9148306-9148328 CCATCAAAGGCCAGGTGGGTGTA 0: 2
1: 33
2: 47
3: 110
4: 193
Right 1003758381 6:9148319-9148341 GGTGGGTGTAACTACCGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003758381 Original CRISPR GGTGGGTGTAACTACCGTAA TGG Intergenic
No off target data available for this crispr