ID: 1003760182

View in Genome Browser
Species Human (GRCh38)
Location 6:9171212-9171234
Sequence TGTGCTCCTGGGAGAACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003760176_1003760182 -1 Left 1003760176 6:9171190-9171212 CCAAGAAGATGGAATAACAAACT No data
Right 1003760182 6:9171212-9171234 TGTGCTCCTGGGAGAACAGGGGG No data
1003760174_1003760182 15 Left 1003760174 6:9171174-9171196 CCTGGAAGGATGTACACCAAGAA No data
Right 1003760182 6:9171212-9171234 TGTGCTCCTGGGAGAACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003760182 Original CRISPR TGTGCTCCTGGGAGAACAGG GGG Intergenic
No off target data available for this crispr