ID: 1003760357

View in Genome Browser
Species Human (GRCh38)
Location 6:9172729-9172751
Sequence CAGGCTAAGGACTCTGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003760351_1003760357 12 Left 1003760351 6:9172694-9172716 CCCTATGGTCTAAGAAGAATGTA No data
Right 1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG No data
1003760352_1003760357 11 Left 1003760352 6:9172695-9172717 CCTATGGTCTAAGAAGAATGTAT No data
Right 1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG No data
1003760349_1003760357 24 Left 1003760349 6:9172682-9172704 CCCGGAGAATGACCCTATGGTCT No data
Right 1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG No data
1003760350_1003760357 23 Left 1003760350 6:9172683-9172705 CCGGAGAATGACCCTATGGTCTA 0: 17
1: 28
2: 44
3: 36
4: 91
Right 1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003760357 Original CRISPR CAGGCTAAGGACTCTGGGAG TGG Intergenic
No off target data available for this crispr