ID: 1003761093

View in Genome Browser
Species Human (GRCh38)
Location 6:9179916-9179938
Sequence CAAGTTCTTCAGTTGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003761093_1003761097 -5 Left 1003761093 6:9179916-9179938 CCAAGTTCCAACTGAAGAACTTG No data
Right 1003761097 6:9179934-9179956 ACTTGGAGTCCGATGTTCAAGGG 0: 86
1: 533
2: 1055
3: 1289
4: 1144
1003761093_1003761096 -6 Left 1003761093 6:9179916-9179938 CCAAGTTCCAACTGAAGAACTTG No data
Right 1003761096 6:9179933-9179955 AACTTGGAGTCCGATGTTCAAGG 0: 89
1: 527
2: 1093
3: 1364
4: 1155
1003761093_1003761102 28 Left 1003761093 6:9179916-9179938 CCAAGTTCCAACTGAAGAACTTG No data
Right 1003761102 6:9179967-9179989 CCAGCATCGGAGAAAGATGTAGG No data
1003761093_1003761100 15 Left 1003761093 6:9179916-9179938 CCAAGTTCCAACTGAAGAACTTG No data
Right 1003761100 6:9179954-9179976 GGGCAGGAAGCATCCAGCATCGG 0: 643
1: 1474
2: 1336
3: 748
4: 558
1003761093_1003761098 -1 Left 1003761093 6:9179916-9179938 CCAAGTTCCAACTGAAGAACTTG No data
Right 1003761098 6:9179938-9179960 GGAGTCCGATGTTCAAGGGCAGG 0: 63
1: 586
2: 1184
3: 1526
4: 1194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003761093 Original CRISPR CAAGTTCTTCAGTTGGAACT TGG (reversed) Intergenic
No off target data available for this crispr