ID: 1003769623

View in Genome Browser
Species Human (GRCh38)
Location 6:9284723-9284745
Sequence GGGGCATTCCTTTCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003769618_1003769623 10 Left 1003769618 6:9284690-9284712 CCTAAATATTCATGCTATACTGG No data
Right 1003769623 6:9284723-9284745 GGGGCATTCCTTTCAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003769623 Original CRISPR GGGGCATTCCTTTCAAAAAC AGG Intergenic
No off target data available for this crispr