ID: 1003769863

View in Genome Browser
Species Human (GRCh38)
Location 6:9288308-9288330
Sequence TAGAATAACAATGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003769856_1003769863 23 Left 1003769856 6:9288262-9288284 CCTCACCAATGTGGGTGGGTGTC No data
Right 1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG No data
1003769858_1003769863 -2 Left 1003769858 6:9288287-9288309 CCCATCCGCTAAGAACTAAAATA No data
Right 1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG No data
1003769857_1003769863 18 Left 1003769857 6:9288267-9288289 CCAATGTGGGTGGGTGTCATCCC No data
Right 1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG No data
1003769855_1003769863 24 Left 1003769855 6:9288261-9288283 CCCTCACCAATGTGGGTGGGTGT No data
Right 1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG No data
1003769859_1003769863 -3 Left 1003769859 6:9288288-9288310 CCATCCGCTAAGAACTAAAATAG No data
Right 1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG No data
1003769860_1003769863 -7 Left 1003769860 6:9288292-9288314 CCGCTAAGAACTAAAATAGAATA No data
Right 1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003769863 Original CRISPR TAGAATAACAATGTGGAGGA AGG Intergenic
No off target data available for this crispr