ID: 1003772348

View in Genome Browser
Species Human (GRCh38)
Location 6:9319426-9319448
Sequence GGAGGAGATGACCATTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003772348_1003772352 -1 Left 1003772348 6:9319426-9319448 CCTCTCAAATGGTCATCTCCTCC No data
Right 1003772352 6:9319448-9319470 CTTCCTAAGATGACATTTGAGGG No data
1003772348_1003772351 -2 Left 1003772348 6:9319426-9319448 CCTCTCAAATGGTCATCTCCTCC No data
Right 1003772351 6:9319447-9319469 CCTTCCTAAGATGACATTTGAGG No data
1003772348_1003772354 14 Left 1003772348 6:9319426-9319448 CCTCTCAAATGGTCATCTCCTCC No data
Right 1003772354 6:9319463-9319485 TTTGAGGGTCAAGTAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003772348 Original CRISPR GGAGGAGATGACCATTTGAG AGG (reversed) Intergenic
No off target data available for this crispr