ID: 1003772352

View in Genome Browser
Species Human (GRCh38)
Location 6:9319448-9319470
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003772347_1003772352 0 Left 1003772347 6:9319425-9319447 CCCTCTCAAATGGTCATCTCCTC No data
Right 1003772352 6:9319448-9319470 CTTCCTAAGATGACATTTGAGGG No data
1003772346_1003772352 3 Left 1003772346 6:9319422-9319444 CCTCCCTCTCAAATGGTCATCTC No data
Right 1003772352 6:9319448-9319470 CTTCCTAAGATGACATTTGAGGG No data
1003772348_1003772352 -1 Left 1003772348 6:9319426-9319448 CCTCTCAAATGGTCATCTCCTCC No data
Right 1003772352 6:9319448-9319470 CTTCCTAAGATGACATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003772352 Original CRISPR CTTCCTAAGATGACATTTGA GGG Intergenic
No off target data available for this crispr