ID: 1003772354

View in Genome Browser
Species Human (GRCh38)
Location 6:9319463-9319485
Sequence TTTGAGGGTCAAGTAAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003772348_1003772354 14 Left 1003772348 6:9319426-9319448 CCTCTCAAATGGTCATCTCCTCC No data
Right 1003772354 6:9319463-9319485 TTTGAGGGTCAAGTAAATAAAGG No data
1003772350_1003772354 -7 Left 1003772350 6:9319447-9319469 CCTTCCTAAGATGACATTTGAGG No data
Right 1003772354 6:9319463-9319485 TTTGAGGGTCAAGTAAATAAAGG No data
1003772346_1003772354 18 Left 1003772346 6:9319422-9319444 CCTCCCTCTCAAATGGTCATCTC No data
Right 1003772354 6:9319463-9319485 TTTGAGGGTCAAGTAAATAAAGG No data
1003772349_1003772354 -4 Left 1003772349 6:9319444-9319466 CCTCCTTCCTAAGATGACATTTG No data
Right 1003772354 6:9319463-9319485 TTTGAGGGTCAAGTAAATAAAGG No data
1003772347_1003772354 15 Left 1003772347 6:9319425-9319447 CCCTCTCAAATGGTCATCTCCTC No data
Right 1003772354 6:9319463-9319485 TTTGAGGGTCAAGTAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003772354 Original CRISPR TTTGAGGGTCAAGTAAATAA AGG Intergenic
No off target data available for this crispr