ID: 1003772449

View in Genome Browser
Species Human (GRCh38)
Location 6:9321224-9321246
Sequence ATCTCGGAAGCCCATACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003772449_1003772452 20 Left 1003772449 6:9321224-9321246 CCTTTTGTATGGGCTTCCGAGAT No data
Right 1003772452 6:9321267-9321289 GGATTTCATGCATTTTAGAAAGG No data
1003772449_1003772451 -1 Left 1003772449 6:9321224-9321246 CCTTTTGTATGGGCTTCCGAGAT No data
Right 1003772451 6:9321246-9321268 TGATCATTATTTCTGTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003772449 Original CRISPR ATCTCGGAAGCCCATACAAA AGG (reversed) Intergenic
No off target data available for this crispr