ID: 1003773641

View in Genome Browser
Species Human (GRCh38)
Location 6:9335745-9335767
Sequence GGGAGGGTAGGGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003773641_1003773652 7 Left 1003773641 6:9335745-9335767 CCTGCTTCCCTCCCTACCCTCCC No data
Right 1003773652 6:9335775-9335797 GTATAGAATTCAGTCTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003773641 Original CRISPR GGGAGGGTAGGGAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr