ID: 1003776728 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:9375164-9375186 |
Sequence | CAATCCCTGATTGTTTCTGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1003776728_1003776731 | 11 | Left | 1003776728 | 6:9375164-9375186 | CCCTCAGAAACAATCAGGGATTG | No data | ||
Right | 1003776731 | 6:9375198-9375220 | CTGTATAAACACATGCACCATGG | No data | ||||
1003776728_1003776732 | 19 | Left | 1003776728 | 6:9375164-9375186 | CCCTCAGAAACAATCAGGGATTG | No data | ||
Right | 1003776732 | 6:9375206-9375228 | ACACATGCACCATGGTCCCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1003776728 | Original CRISPR | CAATCCCTGATTGTTTCTGA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |