ID: 1003776729

View in Genome Browser
Species Human (GRCh38)
Location 6:9375165-9375187
Sequence TCAATCCCTGATTGTTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003776729_1003776731 10 Left 1003776729 6:9375165-9375187 CCTCAGAAACAATCAGGGATTGA No data
Right 1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG No data
1003776729_1003776732 18 Left 1003776729 6:9375165-9375187 CCTCAGAAACAATCAGGGATTGA No data
Right 1003776732 6:9375206-9375228 ACACATGCACCATGGTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003776729 Original CRISPR TCAATCCCTGATTGTTTCTG AGG (reversed) Intergenic
No off target data available for this crispr