ID: 1003785893

View in Genome Browser
Species Human (GRCh38)
Location 6:9486677-9486699
Sequence TTGACCTTCCAGCAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003785891_1003785893 -2 Left 1003785891 6:9486656-9486678 CCTGGGATTGGAGTGGGGGTATT No data
Right 1003785893 6:9486677-9486699 TTGACCTTCCAGCAGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003785893 Original CRISPR TTGACCTTCCAGCAGAGTGA GGG Intergenic
No off target data available for this crispr