ID: 1003791217

View in Genome Browser
Species Human (GRCh38)
Location 6:9549963-9549985
Sequence AGTTATCTTCAGAAGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003791217_1003791224 25 Left 1003791217 6:9549963-9549985 CCTACCATCTTCTGAAGATAACT No data
Right 1003791224 6:9550011-9550033 GGCCTATTACTGGGATTTGGTGG No data
1003791217_1003791223 22 Left 1003791217 6:9549963-9549985 CCTACCATCTTCTGAAGATAACT No data
Right 1003791223 6:9550008-9550030 CTTGGCCTATTACTGGGATTTGG No data
1003791217_1003791222 16 Left 1003791217 6:9549963-9549985 CCTACCATCTTCTGAAGATAACT No data
Right 1003791222 6:9550002-9550024 ACAGCTCTTGGCCTATTACTGGG 0: 16
1: 194
2: 203
3: 147
4: 222
1003791217_1003791219 4 Left 1003791217 6:9549963-9549985 CCTACCATCTTCTGAAGATAACT No data
Right 1003791219 6:9549990-9550012 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1003791217_1003791221 15 Left 1003791217 6:9549963-9549985 CCTACCATCTTCTGAAGATAACT No data
Right 1003791221 6:9550001-9550023 GACAGCTCTTGGCCTATTACTGG 0: 17
1: 183
2: 194
3: 123
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003791217 Original CRISPR AGTTATCTTCAGAAGATGGT AGG (reversed) Intergenic
No off target data available for this crispr