ID: 1003791219

View in Genome Browser
Species Human (GRCh38)
Location 6:9549990-9550012
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 964
Summary {0: 181, 1: 197, 2: 163, 3: 130, 4: 293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003791215_1003791219 27 Left 1003791215 6:9549940-9549962 CCTCTAGGAGTTTGGAGGAAGGC No data
Right 1003791219 6:9549990-9550012 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1003791217_1003791219 4 Left 1003791217 6:9549963-9549985 CCTACCATCTTCTGAAGATAACT No data
Right 1003791219 6:9549990-9550012 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1003791218_1003791219 0 Left 1003791218 6:9549967-9549989 CCATCTTCTGAAGATAACTACTC No data
Right 1003791219 6:9549990-9550012 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1003791216_1003791219 5 Left 1003791216 6:9549962-9549984 CCCTACCATCTTCTGAAGATAAC No data
Right 1003791219 6:9549990-9550012 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003791219 Original CRISPR TCCTTTTGAGAGACAGCTCT TGG Intergenic
900075769 1:816048-816070 TTCTCTTGAGAGCCAGCTTTTGG - Intergenic
900519146 1:3097332-3097354 TCCTTTGGAGATGCAGCCCTCGG - Intronic
901444628 1:9300549-9300571 TCCTTTTGAGAGACAGCTCTTGG + Intronic
901904050 1:12392659-12392681 TCCTTTTGAGAGACAGCTCTTGG - Intronic
902115684 1:14119088-14119110 TCTTTTTCAGAGACAACACTAGG + Intergenic
902560458 1:17274169-17274191 TGCTTCTGAGAGATAGCCCTGGG + Intronic
904179492 1:28655946-28655968 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
904335933 1:29798011-29798033 TCCTCTTGAGAGACAGCTCTTGG + Intergenic
904372992 1:30062401-30062423 TGCATTTGAGAAATAGCTCTTGG + Intergenic
904419579 1:30383024-30383046 TCCTTTTGAGAAATAGCTCCTGG - Intergenic
905877147 1:41439456-41439478 ACCTTTTGAGAAACAGTTCCTGG + Intergenic
906050490 1:42867439-42867461 TTCTTTGGAGAGACAGCTCTTGG + Intergenic
906884320 1:49628115-49628137 GCCTTTTGAGAAACAGCTCCTGG - Intronic
906921729 1:50071664-50071686 TCATGTTCAGATACAGCTCTTGG - Intronic
907732825 1:57084471-57084493 TACTTTGGAGAAACAGCCCTTGG + Intronic
907780342 1:57560859-57560881 TCCTTTTGAGAGTCAGCTCTTGG + Intronic
908668990 1:66524776-66524798 TTCTTTTGAGAAACAGCTTTCGG + Intergenic
908807458 1:67946020-67946042 TCGTTTTGAGAGACATATCTAGG + Intergenic
909278734 1:73722148-73722170 TCCTTTTGAGAGTCAGCTCTTGG + Intergenic
909576921 1:77185883-77185905 TCCTTTTGAGAGACAGCTCTTGG + Intronic
909781253 1:79550362-79550384 TCCTTTTGATAAACAGCTCTTGG + Intergenic
909781421 1:79551849-79551871 TTCTTCAGAGAGACAGCTTTGGG - Intergenic
909810955 1:79931362-79931384 TCTTCTTTTGAGACAGCTCTTGG + Intergenic
910069650 1:83196380-83196402 TAATTTTCAGAGACATCTCTAGG + Intergenic
910141289 1:84030014-84030036 TACTTTTGAGAAACAGCTCTTGG + Intergenic
910370635 1:86512153-86512175 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
910561902 1:88600006-88600028 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
910630222 1:89346277-89346299 TCCTTCTGAGAGGCAGCTCTTGG + Intergenic
910638990 1:89439949-89439971 TCCTTTTGAGAGACAACTCTTGG - Intergenic
910790322 1:91043745-91043767 TCCTTTTGAGAGACAGCTGTTGG + Intergenic
910831097 1:91463399-91463421 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
910948215 1:92616713-92616735 TCCTTTTGAGAGACAGCTGTTGG + Intronic
911109097 1:94164180-94164202 TCCATTTGAGAGACAACTCTTGG - Intronic
911257324 1:95647339-95647361 TCCTTTTGAGAGGCAGCTCTTGG - Intergenic
911642332 1:100302577-100302599 TTCTTTTCAGAAACAGATCTTGG + Intergenic
911738397 1:101361894-101361916 TCCTTTTGAGACACAGCTCTTGG - Intergenic
911883574 1:103270474-103270496 CCCTTTTGAGAGACAGCTCTTGG + Intergenic
911974261 1:104471731-104471753 TCCTTTTGAGAAACAGCATTAGG + Intergenic
911980427 1:104559446-104559468 TCCTTTTGAGAGACAACTCTTGG + Intergenic
911981898 1:104579237-104579259 TCTTTTTGAGAGAAAACTCTTGG - Intergenic
912050676 1:105524922-105524944 TCTTTTTGAAAGATAACTCTTGG - Intergenic
912067023 1:105756972-105756994 TTCCTTTAAGAGACAGCTCTTGG + Intergenic
912107463 1:106298104-106298126 TCCTTAGGAGAAACAGCGCTAGG - Intergenic
912129911 1:106588025-106588047 TCCTTTTAAGAGACAACTCTTGG - Intergenic
912212253 1:107568919-107568941 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
912252029 1:108021363-108021385 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
912730625 1:112099807-112099829 TCCATTTGAAAGACAGCTCCTGG + Intergenic
912733322 1:112128804-112128826 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
913966692 1:143382749-143382771 TCTTTTGGAGGGTCAGCTCTGGG - Intergenic
914061069 1:144208356-144208378 TCTTTTGGAGGGTCAGCTCTGGG - Intergenic
914118081 1:144758013-144758035 TCTTTTGGAGGGTCAGCTCTGGG + Intergenic
915650534 1:157307339-157307361 TCCTTCAGAGAGAAAACTCTGGG - Intergenic
915667670 1:157459618-157459640 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
916017357 1:160761967-160761989 TCCTTTTGAGAAAGAGCACTTGG - Intergenic
916106329 1:161435302-161435324 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
916285317 1:163099553-163099575 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
916365967 1:164028062-164028084 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
917217213 1:172690888-172690910 TCCTTTTGAGAGGCAGCTCTTGG - Intergenic
917276497 1:173337219-173337241 TCTTATTGAGAAACAACTCTTGG + Intergenic
917453600 1:175167417-175167439 TCCTTTTCAGGGACAGCAATGGG - Intronic
917456983 1:175193497-175193519 TGCTTGTGACAGACAGCTCCTGG - Intergenic
917462708 1:175246208-175246230 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
918007623 1:180556832-180556854 GCCCTTTGAAAAACAGCTCTTGG + Intergenic
918755713 1:188337784-188337806 TCCTTTTGAGAGATGGCTCTTGG - Intergenic
918815079 1:189171253-189171275 TCTTTTTGAGAACCAGCTCTTGG + Intergenic
918918231 1:190671854-190671876 TCCTTCTGAGAGACAGCTCTTGG - Intergenic
918958246 1:191237974-191237996 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
919241773 1:194924229-194924251 TCCTTTTGAGAGACAGCTATTGG + Intergenic
919317974 1:195999387-195999409 TCCTTTTGAGGGATAGCTTTTGG + Intergenic
920197431 1:204238391-204238413 TCCTTTTGAGAGACACCTGTTGG + Intronic
920679992 1:208064911-208064933 TGCTTTTAAGAGAGAGCCCTGGG - Intronic
920898514 1:210082778-210082800 CTGTTTTGAGAAACAGCTCTTGG - Intronic
921368294 1:214395861-214395883 TAATTTTGAGACTCAGCTCTGGG + Intronic
921619820 1:217313162-217313184 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
922220704 1:223556531-223556553 TCTTTATGACTGACAGCTCTTGG - Intronic
922271617 1:224040929-224040951 TTCTCTTGAGAGCCAGCTTTTGG - Intergenic
922683084 1:227617122-227617144 TTCTTTTGATAGAAAGTTCTTGG + Intronic
922781047 1:228252556-228252578 TCATTTTGAGAGACAGCTCTTGG - Intronic
923253569 1:232199412-232199434 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
924182507 1:241453216-241453238 TTTTCTTGAGAGACAGTTCTTGG - Intergenic
924477398 1:244394176-244394198 TCCTTTTGAGAGACAACTCTTGG - Intergenic
924491844 1:244545605-244545627 TCCTTTTAGGAGACAATTCTTGG + Intronic
924840776 1:247707807-247707829 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
924847133 1:247785113-247785135 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
924910868 1:248511833-248511855 TGCTTTTGAAAGACATCTCCTGG - Intergenic
924913233 1:248536207-248536229 TGCTTTTGAAAGACATCTCCTGG + Intergenic
1063437811 10:6048750-6048772 TACTTTGGAGAGACAGCATTGGG - Intronic
1064139965 10:12782025-12782047 TCCTCATGAATGACAGCTCTAGG + Intronic
1064519446 10:16186049-16186071 TACTTTCAAGAGACAGCTCTTGG - Intergenic
1064545688 10:16448110-16448132 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1065005327 10:21374189-21374211 TCATTTTTAGAGACAGCTCTTGG + Intergenic
1065701230 10:28427366-28427388 CCATTTTGGGAAACAGCTCTTGG + Intergenic
1065779904 10:29157612-29157634 CCCTTTTGGAAGAGAGCTCTGGG - Intergenic
1066167027 10:32799205-32799227 TCCTTTTGAGAGTCAGCTCTTGG - Intronic
1067125553 10:43512519-43512541 TCCTTATGAGAGACAGTTCTTGG - Intergenic
1067151127 10:43735743-43735765 ACCTTTTCAGAGACAGCTTCTGG + Intergenic
1067333140 10:45340242-45340264 TGCTTTTGAAAGACAGCTCTTGG + Intergenic
1067518967 10:46980510-46980532 TCTTTTTGAGAAACAGCTTTTGG + Intronic
1067643279 10:48071324-48071346 TCTTTTTGAGAAACAGCTTTTGG - Intergenic
1067754348 10:48993694-48993716 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1067762774 10:49060896-49060918 TCCTTTTGACAGACAGTGCTGGG - Intronic
1068007673 10:51409545-51409567 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1068447210 10:57138618-57138640 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1068837216 10:61568353-61568375 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1068908867 10:62357309-62357331 TCCTGTTGAGAGACAGCTCTTGG + Intergenic
1069145763 10:64890465-64890487 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1069192305 10:65506345-65506367 TCCTTTTGAGAGACAGCCCTTGG - Intergenic
1069790831 10:71019558-71019580 TCCTTTTGAGAGACAGCCCTTGG - Intergenic
1071013897 10:80971700-80971722 TCCATCTGAGAAACAGCTTTTGG - Intergenic
1071060221 10:81561322-81561344 TCCTTTGGAAGGACAGATCTAGG - Intergenic
1071267086 10:83973977-83973999 TCCTTTTAAGAGACAGCCCTTGG - Intergenic
1071364468 10:84884496-84884518 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1071378384 10:85033382-85033404 TCCTTTTGAGAGATAGCTCTTGG + Intergenic
1071673927 10:87637404-87637426 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
1071700088 10:87922118-87922140 CTCTTTCGCGAGACAGCTCTAGG - Intronic
1071937689 10:90549301-90549323 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1071942785 10:90607753-90607775 TCCTTTTGAGAGACCGCCCTTGG - Intergenic
1071947086 10:90657706-90657728 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
1071950799 10:90700912-90700934 TCCTTTTGAAAGACAGCTTTTGG - Intergenic
1072209258 10:93231653-93231675 TCCTTTTGAGAGACAGATCTTGG - Intergenic
1072360469 10:94654168-94654190 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1072715430 10:97749371-97749393 TCCAGGTGAGACACAGCTCTGGG - Intronic
1073557349 10:104465925-104465947 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1073656680 10:105424459-105424481 CTCTTCTGAGATACAGCTCTTGG - Intergenic
1073830504 10:107377984-107378006 TCTTTTTGAGAGACAGTTCTTGG - Intergenic
1073918476 10:108432290-108432312 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1073957682 10:108891628-108891650 CCCTTTTGAGAGACAGCTCTTGG - Intergenic
1073995873 10:109314692-109314714 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
1074087717 10:110221248-110221270 TCAGTTTGATAGACAGCTGTTGG + Intronic
1074235653 10:111582084-111582106 TTCTTTTGAGAAATGGCTCTTGG - Intergenic
1074881399 10:117662176-117662198 GCCTTTGGAGAGGCACCTCTAGG - Intergenic
1075606789 10:123817424-123817446 TCCTTTTGAGAGACAGCACTTGG + Intronic
1076123291 10:127953370-127953392 TCCTTTTGAGAGACAACTCTTGG + Intronic
1076657543 10:132034964-132034986 CCCTTTTGAGAAACAGCTGCTGG + Intergenic
1076772629 10:132674814-132674836 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1077209324 11:1361209-1361231 TCCTTTGGAGACCCAGCTCCTGG - Intergenic
1077381080 11:2237928-2237950 TCCTTTGGAGAGACAGGGCTTGG + Intergenic
1077669468 11:4144598-4144620 TCCTTTTGAGAAATAGCTTTTGG + Intergenic
1077704260 11:4468852-4468874 TCCTTTTAAGATAAAGCTGTAGG + Intergenic
1077975489 11:7243908-7243930 CCACTTTGAAAGACAGCTCTAGG + Intronic
1078090333 11:8261107-8261129 CGCTTTTGAAAGACAGCTATGGG + Intronic
1078195293 11:9132118-9132140 ACCTTTTGAGAAACAGTTCCTGG + Intronic
1078390999 11:10935274-10935296 TCCTCTTAAGGGGCAGCTCTGGG + Intergenic
1078798866 11:14622935-14622957 GTCTTTTGAGAAAAAGCTCTTGG + Intronic
1079202538 11:18387852-18387874 GCATTTTGGGAGACAGATCTGGG + Intergenic
1080020139 11:27551641-27551663 TTCTTTTGAGAGACAGCTCTGGG - Intergenic
1080076593 11:28157520-28157542 CCCTTTTGAGAGACAGCTCTTGG + Intronic
1080798267 11:35585982-35586004 ACCTCCTGGGAGACAGCTCTGGG + Intergenic
1080976680 11:37350597-37350619 TCCTTTTGAGAGACAGCTTTTGG + Intergenic
1081065460 11:38534877-38534899 TCTTTTTGAGAGGCAGCTCTTGG - Intergenic
1081072776 11:38631120-38631142 TCCTTTTGAGAGACATTTCTTGG + Intergenic
1081110477 11:39128418-39128440 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1081609061 11:44547877-44547899 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1082154390 11:48787159-48787181 TCCTTCTGAGAAACTGCTCTAGG - Intergenic
1082159274 11:48868169-48868191 TCCTTTTGATAGAGCGCTATTGG + Intergenic
1082991672 11:59212056-59212078 TCGGTTTGAGAGGTAGCTCTTGG + Exonic
1083000776 11:59288679-59288701 TCGGTTTGAGAGGTAGCTCTTGG + Intergenic
1083695692 11:64440768-64440790 CCCTGTTGAGAGCCATCTCTGGG + Intergenic
1084414476 11:69023312-69023334 TCCTTTTGAAAAACAGCTTCTGG - Intergenic
1084723165 11:70922526-70922548 TTCTTTTGAAAGACTGCTGTCGG - Intronic
1085079266 11:73620721-73620743 CCCTTTTGAGAAACAGCTCTTGG + Intergenic
1085684621 11:78610416-78610438 TTCTTTTGAGTAACAGCTCTTGG + Intergenic
1085685962 11:78622189-78622211 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1085747570 11:79128239-79128261 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1086278612 11:85160451-85160473 TCCTTTTGAGAAACAGCTCTTGG + Intronic
1086834115 11:91600392-91600414 TCCTTTTGGGAGACAGCTCTTGG + Intergenic
1087021604 11:93608728-93608750 TCTTTTTGAGAAATAGCTCTTGG - Intergenic
1087374021 11:97320553-97320575 TCCTTTTGAGAGACACCTCTTGG + Intergenic
1088097204 11:106115157-106115179 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1088191660 11:107234491-107234513 TTCTTTTGAGAGACAGTTCTTGG - Intergenic
1088407612 11:109498663-109498685 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1088449355 11:109965367-109965389 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
1088836655 11:113583388-113583410 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1089903606 11:122013608-122013630 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1089961801 11:122623275-122623297 TCATTTTAAGAGGCAGCTCAGGG + Intergenic
1090209493 11:124908051-124908073 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1090575129 11:128094202-128094224 TCCCTCTGAGAGTCAGCTCTTGG + Intergenic
1090789150 11:130075312-130075334 TCATTTTGAAAAACAGATCTTGG - Intronic
1090891791 11:130930117-130930139 TCCTTTTGAGGAACAGTTTTTGG - Intergenic
1091051739 11:132378755-132378777 TCCTTTTGAGAGGCAGCTTTTGG + Intergenic
1091212417 11:133873524-133873546 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
1091491581 12:937169-937191 TCCTCCTGGGAGACAGCTTTAGG + Intronic
1092093283 12:5821650-5821672 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1092381560 12:8000938-8000960 TCCTTTTGAGAGACAGCTCCTGG + Intergenic
1093031870 12:14295950-14295972 TTTTTTTAAGAGACAGCTGTTGG - Intergenic
1093036336 12:14335683-14335705 CCCTTTTGAGAGACAGCTCTTGG + Intergenic
1093048924 12:14484968-14484990 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1093049671 12:14490963-14490985 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1093645729 12:21583670-21583692 TCTTTTAGGGAGAAAGCTCTTGG + Intronic
1093964540 12:25310956-25310978 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1094102529 12:26779262-26779284 TCCTTTGGAGAGACAGCTCTTGG + Intronic
1094376815 12:29799345-29799367 TCCTTTTGGAAGACATCTCCCGG + Intergenic
1094867615 12:34556423-34556445 CCTTTTTGAGAGACTGCTTTGGG - Intergenic
1095074448 12:37899535-37899557 TCATTTTGAGAAACTGCTTTTGG - Intergenic
1095121506 12:38424844-38424866 TCTTTTTGAGAGGCAACTCTTGG - Intergenic
1095289300 12:40458721-40458743 TCCTTTTTAGGAACAACTCTAGG + Exonic
1095603853 12:44044334-44044356 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1095634272 12:44413904-44413926 CTCCTTTGAGAAACAGCTCTTGG - Intergenic
1095844396 12:46729968-46729990 CCCTTTTGAGCAACAGCTCTTGG - Intergenic
1095856241 12:46863675-46863697 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1096288712 12:50322960-50322982 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1096457467 12:51799437-51799459 GCCTTTTGAGGGACGGCTCTTGG - Intronic
1096734787 12:53644200-53644222 TCCTTTTGAGAAGTAGCTCTTGG + Intronic
1096758275 12:53818150-53818172 TCCTTTAGAGTGACACTTCTTGG - Intergenic
1096967951 12:55643543-55643565 TCCTTTTGTGAAACTGCTCTTGG + Intergenic
1097437839 12:59572254-59572276 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1097500544 12:60395245-60395267 TCCTTTAGAGAGACAGGAATAGG + Intergenic
1097821342 12:64131864-64131886 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1097843358 12:64342761-64342783 TCCTTTTGAGAAACAGCTCTTGG - Intronic
1098113674 12:67151772-67151794 TCCTTGGGGGAGACAGATCTGGG - Intergenic
1098158367 12:67623617-67623639 TTCTTTTAAGAAACAGCTTTTGG + Intergenic
1098587065 12:72166453-72166475 TCCTTTTGAAGAACAGCTCTTGG + Intronic
1098673040 12:73254244-73254266 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1098716089 12:73829815-73829837 TCCTTTTGAGAGACAGTTCTTGG + Intergenic
1098731050 12:74037348-74037370 TCCTTTTGAGAGACAGCTGTTGG + Intergenic
1098733291 12:74065631-74065653 TCCTTTGGAGAGAAAGCTCTTGG + Intergenic
1098807195 12:75034973-75034995 TCCTTTTAAGAAACAGCTCTTGG + Intergenic
1098831905 12:75374025-75374047 TCATTTTGAGAGAAAGCTCTTGG - Intronic
1099183380 12:79492588-79492610 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
1099365923 12:81765384-81765406 TCCTTTCGAGAGACAGCTCTTGG + Intergenic
1099375648 12:81893957-81893979 TATTTTTAAGAGACAGCTCTTGG + Intergenic
1099379382 12:81936540-81936562 TCTTTTTGAGAGGCAGCTCTTGG - Intergenic
1099508560 12:83507187-83507209 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1099578075 12:84405391-84405413 TCCTTTTGAGAGGCAGCTTTTGG + Intergenic
1099589499 12:84569484-84569506 TAATTTTGAGAGATAGCTCCTGG - Intergenic
1099735784 12:86565039-86565061 TCTTCTTGAGAGACAGCTCTTGG + Intronic
1099995066 12:89769530-89769552 TCCTTTTGAGAAATACCTCTTGG - Intergenic
1100241153 12:92711608-92711630 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1101264130 12:103066122-103066144 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1101534668 12:105606104-105606126 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1101543071 12:105682636-105682658 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1101572399 12:105965922-105965944 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1101697458 12:107139830-107139852 TCCTTTTGAGAAAAAGCTCTTGG - Intergenic
1102211235 12:111128689-111128711 GCTTTTTGAGAAACAGCTCTTGG - Intronic
1103035611 12:117654063-117654085 TCCTTTTAAGAGACAGCTCTTGG + Intronic
1103352498 12:120294564-120294586 TTCTTTTTTGAGACAGCTTTTGG + Intergenic
1103980552 12:124734391-124734413 TCCTTTTCAGAGTCAGGTATAGG + Intergenic
1104497256 12:129252482-129252504 TCTTTCTGAGAGACAATTCTGGG - Intronic
1105740108 13:23315176-23315198 TCCTTTTGAGAGACAACTCTTGG + Intronic
1107983577 13:45755972-45755994 TCCTCTTGAGAGACAGCTCTTGG - Intergenic
1108302435 13:49091985-49092007 TCCTTTGGAGAGACAGCTCTTGG - Intronic
1108904277 13:55449971-55449993 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1108914302 13:55588871-55588893 TCCTTTTGAAAGACAGCTCTTGG - Intergenic
1109293224 13:60500118-60500140 TTTTTTTGAGAGACGGCTCTTGG + Intronic
1109488057 13:63054660-63054682 TCTTTTCGAGAAACAGCCCTTGG + Intergenic
1109519021 13:63484801-63484823 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1109583047 13:64366167-64366189 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1109712681 13:66180822-66180844 TGATTTTTAGAGACAGCTCTTGG - Intergenic
1109933293 13:69245175-69245197 TCCTCTTGAGAAACAGTTCTTGG - Intergenic
1109951025 13:69502205-69502227 ACCTTTTGAGAGACAGCTCTTGG - Intergenic
1110143764 13:72164814-72164836 TCCCTTTGAGAAACAGGTCTAGG - Intergenic
1110377172 13:74806469-74806491 TTTTTTTGAGAGACAGCTCTTGG + Intergenic
1110578445 13:77088952-77088974 TCCTTTAGAAAGAGAGCTGTGGG + Exonic
1110834136 13:80064629-80064651 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1111044399 13:82795986-82796008 TCCTTTTGAGACATAGCTTTTGG + Intergenic
1111057799 13:82973027-82973049 CCAGTTTGAGAGACAGCTCTTGG - Intergenic
1111432254 13:88159634-88159656 TCCTTTTGAAAGACAGATCTTGG - Intergenic
1112231127 13:97590164-97590186 TTCTTTTGAGAGATAGCTCTTGG - Intergenic
1112249929 13:97770278-97770300 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1112389889 13:98973577-98973599 TTCTTTTCAGAGACACCTTTTGG - Intronic
1113027238 13:105954594-105954616 TGCTTTTGGGAGACAGATTTGGG + Intergenic
1114205870 14:20570769-20570791 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
1114390793 14:22306163-22306185 TCCTTCTTAGAGAGAACTCTTGG + Intergenic
1114396695 14:22370064-22370086 TTTTTTTGAGAAACAGCTCTTGG - Intergenic
1114477322 14:23005805-23005827 TCCTTTAGACAGACAGTTCAGGG + Intronic
1114896346 14:26995300-26995322 TTCTTCTGAGAAACAGTTCTTGG - Intergenic
1114905376 14:27120422-27120444 TCCTTATGAGAGACAGCTATTGG - Intergenic
1114965615 14:27955651-27955673 TCCTCATGAGAAACAGTTCTTGG - Intergenic
1115059715 14:29173894-29173916 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1115130692 14:30049260-30049282 TCCTATTAAGAGACAGCTCTTGG + Intronic
1115143399 14:30199387-30199409 TTCTTTTGAGAGGCAACTCTTGG + Intergenic
1115512668 14:34153268-34153290 TCCTTTCAAAAAACAGCTCTTGG - Intronic
1116058907 14:39896938-39896960 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1116158380 14:41236665-41236687 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
1116308045 14:43283447-43283469 TCCTTTGGAAAGACAGCTCTTGG - Intergenic
1116495402 14:45553823-45553845 TCCTGTTGGGGGACAGCTGTTGG + Intergenic
1116531455 14:45978225-45978247 TTCTTTTGAGAAAGAGCTCTTGG - Intergenic
1116696581 14:48184735-48184757 TTCTTTTGAGACTAAGCTCTTGG + Intergenic
1117001598 14:51376312-51376334 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1117216842 14:53560175-53560197 TCCTTTTGAGAGACACCTCTTGG + Intergenic
1117634132 14:57724373-57724395 TCCTTTTGAGAGACAGCTGTTGG + Intronic
1117780115 14:59223384-59223406 TCCTTCTGAGAGACAGCTCTTGG - Intronic
1118880775 14:69824018-69824040 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1119107565 14:71938839-71938861 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1119882182 14:78108858-78108880 TCCTTTAAAGAGCCAGCTGTTGG + Intergenic
1120169406 14:81233986-81234008 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
1120231423 14:81845251-81845273 TTCTTCTGAGAGACAGCTGTTGG - Intergenic
1120250741 14:82059649-82059671 TCTTTTTGAGAGACCACTCTTGG - Intergenic
1120710470 14:87788091-87788113 TCCTTTTGATAAACAGCTTTTGG - Intergenic
1121510347 14:94508063-94508085 TGCTTGTGACAGACAGCTATGGG + Intronic
1121543525 14:94746457-94746479 TCCTTTTGAGCAACAGGCCTAGG - Intergenic
1123908499 15:24943654-24943676 TCCTTTTGAGAAACAGCTGTTGG - Intronic
1125590873 15:40853885-40853907 GGCCTTTGAGAGGCAGCTCTGGG + Exonic
1125881124 15:43196984-43197006 TCGTTTTAACAGCCAGCTCTGGG - Exonic
1126283609 15:46986277-46986299 TCCTTTTAAGAAACAACTCTTGG + Intergenic
1127356915 15:58209189-58209211 TCCTTGGGAGAGACAGCTCTTGG + Intronic
1127849996 15:62903786-62903808 TCTGTTTGAGTGACAGATCTGGG - Intergenic
1128404041 15:67316875-67316897 TGCATTTGAGGGACAGATCTGGG + Intronic
1128642810 15:69352223-69352245 TCCTTTTGGGAGGCAGCTCTTGG + Intronic
1128724107 15:69975196-69975218 TCATTTTGAGAGAAATCTCAGGG - Intergenic
1130645279 15:85720051-85720073 TTTTTTGTAGAGACAGCTCTTGG - Intronic
1130852676 15:87811755-87811777 TCCTTTTAAGAAACAACTTTAGG + Intergenic
1130930309 15:88421785-88421807 TACTCTTGAGAAACAGCTCCTGG + Intergenic
1131724009 15:95202795-95202817 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1132305741 15:100810867-100810889 CTCCTTTGAGAAACAGCTCTTGG - Intergenic
1133292464 16:4731753-4731775 TCCTTTGAAGAGAGAGCTATGGG + Intronic
1134259393 16:12638594-12638616 TCTTTTTTAGAGACAGGTCTTGG - Intergenic
1135061637 16:19276006-19276028 TCCTGTTGAGAGATGGCTCTTGG - Intergenic
1135626002 16:23995496-23995518 TCCTATTAAGAGACAGCTCTTGG + Intronic
1136250941 16:29004591-29004613 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1137151117 16:37214158-37214180 TCTTTCTGAGAAACTGCTCTGGG + Intergenic
1137223769 16:46482196-46482218 TCCTTCTGCGAGACTGGTCTGGG + Intergenic
1138318837 16:56093763-56093785 TCTTTTTGAGAGACAGATCTCGG - Intergenic
1138455987 16:57121046-57121068 ACCTCTTGGGGGACAGCTCTGGG + Intronic
1139727908 16:68916684-68916706 TCCTTTTGAGAAGCAGATCCAGG + Intronic
1141559544 16:84858038-84858060 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1141845823 16:86608286-86608308 TCCGTTTTTCAGACAGCTCTTGG + Intergenic
1141906114 16:87028107-87028129 TCCTTGAGAGAGTCAACTCTTGG - Intergenic
1142588383 17:988584-988606 TCCTTTTGAGACACAGCTTTTGG - Intergenic
1143050116 17:4118350-4118372 TTCTTTTGAGAGACAGCTCCGGG - Intronic
1143334277 17:6160551-6160573 CCCTGTCGGGAGACAGCTCTTGG - Intergenic
1144711802 17:17406148-17406170 TTGTTTGAAGAGACAGCTCTGGG - Intergenic
1146836354 17:36114000-36114022 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1147949375 17:44098424-44098446 TTTTTTTAAGAGACAGCCCTGGG - Intronic
1149986972 17:61354701-61354723 TCCTTTGGAGTGAGAGCTCTTGG + Intronic
1150032790 17:61757455-61757477 TCCTTTTCAGAGAGGGCTGTAGG - Intronic
1150248427 17:63692698-63692720 TCCTGTTGAGAGACTGGTCCAGG - Intronic
1150687631 17:67333303-67333325 TCCATTTCAGAGTCAGCTTTTGG - Intergenic
1150920354 17:69476209-69476231 TCCTTTTAAGAGGCAGAGCTAGG - Intronic
1151512599 17:74570436-74570458 TGCCCTTGAGGGACAGCTCTTGG + Intergenic
1153049134 18:884699-884721 TCCTTTTGAGAAACAGCACTTGG + Intergenic
1153089708 18:1330158-1330180 CCCTTTCGAGAGACAGCTCTTGG + Intergenic
1153184393 18:2470743-2470765 TCCTTTTGAGACATGGCTCTTGG + Intergenic
1153217694 18:2835606-2835628 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1154068464 18:11131095-11131117 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1154129538 18:11724828-11724850 TCCTTTTAAGAAACAACCCTTGG - Intronic
1154252672 18:12757279-12757301 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1154254462 18:12770466-12770488 TCCTTTCGAGAAACAGTTTTTGG + Intergenic
1154506171 18:15042886-15042908 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1155940706 18:31799594-31799616 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1156102900 18:33619918-33619940 TCCTTTTGAGATACGTGTCTAGG + Intronic
1156115576 18:33783595-33783617 TCTTTCTGAGAAACAGCTCAGGG + Intergenic
1156194524 18:34759403-34759425 TCCTTTTTAGGGACAGACCTAGG + Intronic
1156303859 18:35858690-35858712 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1156457614 18:37303622-37303644 TCCTTTTTAGAGCCACGTCTTGG + Intronic
1156606370 18:38671761-38671783 TCCTTTTGAGAGACATTTCTTGG + Intergenic
1156698784 18:39799151-39799173 GCCCTTTAAGAGACAGCTCTAGG + Intergenic
1156990304 18:43400779-43400801 TCTTTTTGAGAGATGGCTCTTGG - Intergenic
1156998578 18:43497725-43497747 TCCTTTTGAGAGATAGCTTTTGG + Intergenic
1157341201 18:46780023-46780045 TCCTTTTGAGAGACAACTCTTGG + Intergenic
1157870933 18:51229585-51229607 TCCTTTCGAAAGATAGCTCTTGG - Intergenic
1157998505 18:52588128-52588150 TCTGTTTAAGAGACAGCTCTTGG - Intronic
1158832720 18:61297799-61297821 TCTGTTTTAGAGACTGCTCTAGG + Intergenic
1159152206 18:64535042-64535064 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
1159277139 18:66235521-66235543 TCCTGTTGAGAAACAGCTCTTGG + Intergenic
1159287788 18:66375478-66375500 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1159456190 18:68662599-68662621 ACCTTTGGAGAAACAGCTGTTGG + Intergenic
1159559106 18:69975355-69975377 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1159711300 18:71764120-71764142 TACTTTTGAGAGACAACTCTTGG + Intronic
1160092462 18:75840011-75840033 TCCTCTTGAGAGACAGCTCTTGG + Intergenic
1163302171 19:16454827-16454849 TTTTTTTAAGAGACAGCTCTGGG + Intronic
1164097087 19:22021347-22021369 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1164117259 19:22234578-22234600 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1165076043 19:33280556-33280578 CCTTTTCAAGAGACAGCTCTTGG - Intergenic
1166211324 19:41308418-41308440 TCCTTGTGAGAGACAATGCTGGG + Intronic
1166262270 19:41648650-41648672 TCCTTTGTAGAGAGAGCACTCGG - Intronic
1167525847 19:49983337-49983359 TCCCTTTGAGATACAGCTCGAGG + Intronic
1168539337 19:57197374-57197396 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1202700476 1_KI270712v1_random:160244-160266 TCTTTTGGAGGGTCAGCTCTGGG - Intergenic
925055942 2:857422-857444 TCCATGTGAGACACAGCTCCAGG - Intergenic
925279952 2:2676864-2676886 TTCTTTTGAGAGACAGCACTTGG + Intergenic
926810397 2:16750680-16750702 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
926825566 2:16902234-16902256 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
926826761 2:16913664-16913686 TCCTTTTGAGAGACAGATCTTGG + Intergenic
927008716 2:18879720-18879742 TCCTTTTGACAGACAGCTCTTGG + Intergenic
927354334 2:22156423-22156445 TCCTTTAGAAAGAAAGATCTGGG + Intergenic
927660431 2:24988665-24988687 TCCTTTTGAGAGACGGCTCTTGG + Intergenic
927693850 2:25227114-25227136 TCCACTTGCAAGACAGCTCTGGG + Intergenic
927923643 2:26993583-26993605 TCCTGTTGAGGGAAAGTTCTGGG + Intronic
928800253 2:35080624-35080646 TCATTTTTAGAGACAGCTCCTGG + Intergenic
928886043 2:36149521-36149543 TCCATTTATCAGACAGCTCTGGG + Intergenic
929269827 2:39960785-39960807 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
929550260 2:42886028-42886050 TCCTTTTGAGAGACAACTCTTGG + Intergenic
930295405 2:49547513-49547535 TCCTTTTGAGAAAGAGCTCTTGG - Intergenic
930536610 2:52652266-52652288 CTCCTTTGAGAGACAACTCTTGG - Intergenic
931455519 2:62407061-62407083 GCCGTTTGAGAAACAGCTTTTGG - Intergenic
932641559 2:73452366-73452388 TCCTGTTGAGAGATAACACTGGG - Exonic
932870708 2:75395085-75395107 TCCTTTTGAGAGACAGCTCCTGG - Intergenic
933265685 2:80178384-80178406 CCTTTTTGAGAGACAGCTCTTGG - Intronic
933394464 2:81713359-81713381 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
934171404 2:89543717-89543739 TCTTTTGGAGGGTCAGCTCTGGG - Intergenic
934281713 2:91618035-91618057 TCTTTTGGAGGGTCAGCTCTGGG - Intergenic
934558138 2:95298162-95298184 ACCTTTTGAGAGTCAGCTAGAGG - Intronic
934910757 2:98252100-98252122 TCCTTCTCAGAGAGACCTCTCGG + Intronic
935183934 2:100714897-100714919 TCCTTTTGACAGACAGCTCTTGG + Intergenic
935425111 2:102911329-102911351 TCCTTTTGAGATACAGCTCTTGG - Intergenic
935428634 2:102948946-102948968 TCATTTTGAGATAAAGCACTTGG + Intergenic
935564310 2:104590255-104590277 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
935577421 2:104725307-104725329 TTCTTTTGAGAAACAGATCTTGG + Intergenic
935823224 2:106915222-106915244 TTCTATTGAGAAGCAGCTCTTGG + Intergenic
935944631 2:108274367-108274389 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
936084992 2:109461309-109461331 TCTTTCTGAGAGATAGTTCTTGG - Intronic
936162684 2:110096562-110096584 TCCTTTAGAGAGGCCTCTCTTGG - Intronic
936641225 2:114314688-114314710 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
936646289 2:114376384-114376406 TCCCTTTGAGGGACAGCTCATGG - Intergenic
936674508 2:114699610-114699632 TCCTCTTAAAACACAGCTCTAGG - Intronic
937582065 2:123499169-123499191 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
937785207 2:125887730-125887752 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
937800326 2:126074726-126074748 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
937817285 2:126265205-126265227 TTCTATTTAGAGACATCTCTAGG - Intergenic
937852571 2:126648740-126648762 TCCTTTTGAGAGACAGCACTTGG - Intergenic
937867150 2:126761080-126761102 TCCTTTTGAGAAAGAGCTCTTGG + Intergenic
938203930 2:129401171-129401193 TCCTTTTGAGAAACAGCTCGTGG + Intergenic
938375538 2:130803370-130803392 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
938899086 2:135783515-135783537 TACTTTCCAGAGACAGCTCCAGG - Exonic
939069061 2:137517854-137517876 TCCTTTTGAAAGGCAGCTCTTGG + Intronic
939213871 2:139212238-139212260 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
939788687 2:146546115-146546137 TCCTTTTGAGAGACAACTCTTGG - Intergenic
939806239 2:146778472-146778494 TCCTTTTGAAAGACAGCTCTCGG + Intergenic
939833624 2:147101856-147101878 TACATTTGAGAGACAGATTTGGG - Intergenic
940158739 2:150688510-150688532 GCCATTTGGAAGACAGCTCTAGG + Intergenic
940171314 2:150832714-150832736 TCCTTTTGAGATACAGCTCTTGG - Intergenic
940426429 2:153536318-153536340 TCCTTGTGAGAACCAGCACTGGG - Intergenic
940544765 2:155069837-155069859 TCCCTTTGAGGAACATCTCTTGG - Intergenic
940605917 2:155924290-155924312 TCCTTTAGAGAGACAGCTCATGG - Intergenic
942221846 2:173776413-173776435 GCCTTTTGAAAAACAACTCTGGG - Intergenic
943006896 2:182395839-182395861 TCCTTTTGAGAGACAGCTCTTGG + Intronic
943239220 2:185362574-185362596 TCCTTTTGAGAGACAACTCTTGG - Intergenic
943317929 2:186412321-186412343 GAGGTTTGAGAGACAGCTCTTGG - Intergenic
943388129 2:187227134-187227156 TGCTTTTGAGAGGCAGCTCTTGG + Intergenic
943517599 2:188907244-188907266 TCCTTTTGAGAGACATCTCTTGG - Intergenic
944372255 2:198998590-198998612 TCCTTTTGAAAAATAGCTCTTGG + Intergenic
944880094 2:204004142-204004164 TCCTTTTCAGAGATAGTCCTAGG + Intergenic
945041778 2:205748724-205748746 TCCTGTTGGAGGACAGCTCTGGG + Intronic
945544869 2:211138155-211138177 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
945642177 2:212443835-212443857 TCCTTTTGAGAGACAGCTCTTGG + Intronic
945717836 2:213380671-213380693 TCCTTTTGAGAGACAGCTCTTGG - Intronic
945725846 2:213471497-213471519 TCCTTTTGAGAGACAGATGTTGG - Intronic
946323866 2:218972695-218972717 TACTTTTGACACACAGTTCTAGG - Intergenic
946527869 2:220539969-220539991 TCCTCTTCAGAGACAGCTCTTGG - Intergenic
946703775 2:222437794-222437816 TCCTTTTGAGAGACAGCTCTTGG - Intronic
946790920 2:223299758-223299780 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
946873542 2:224106443-224106465 CCCTTTCGAGAAACAGCTCTTGG - Intergenic
947440716 2:230118668-230118690 TCCTTTTGAGAGACAGCTCCAGG - Intergenic
947440846 2:230120255-230120277 TCCTTTTGAGAGACAGCTCTGGG + Intergenic
948655677 2:239475539-239475561 TCCTTGTGAGTGACTGTTCTGGG + Intergenic
949081947 2:242108658-242108680 TTCTCTTGAGAGCCAGCTTTTGG + Intergenic
1168945716 20:1755587-1755609 TCTTTCTGAGAAACTGCTCTAGG - Intergenic
1171166171 20:22973929-22973951 TCCTTTTGGGAGACTGCTTCAGG + Intergenic
1171330073 20:24329673-24329695 CCCTTTTGAGAAACAGCTTTTGG - Intergenic
1172622103 20:36324889-36324911 TCTTTTTGAAGGACAGCTTTTGG + Intronic
1176791682 21:13326138-13326160 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1176998159 21:15580182-15580204 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1177139417 21:17342271-17342293 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1177505562 21:22014184-22014206 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
1177781016 21:25622426-25622448 TCCTTTTGAGAAACAGCTTTTGG - Intergenic
1177913174 21:27056208-27056230 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1177933698 21:27316934-27316956 CTTTTTTGAGAGACAGCTCTTGG - Intergenic
1177991072 21:28037140-28037162 TCTTTTTGAGAGACAGCTTGTGG - Intergenic
1178012659 21:28305173-28305195 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1178060756 21:28851140-28851162 TCCTTTTGAGAAACAGTTCTTGG - Intergenic
1178063300 21:28875359-28875381 TCTTTTTGAGAAACAGCTCTTGG - Exonic
1178634465 21:34290195-34290217 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1178697987 21:34810504-34810526 GCTTTTAGAGAGACAGCTCTGGG - Intronic
1179383527 21:40921048-40921070 TCTCTTTTTGAGACAGCTCTTGG + Intergenic
1179415151 21:41192523-41192545 TCCTTCTGAGAGAGAGCTCTTGG - Intronic
1180591148 22:16938369-16938391 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1181156636 22:20926313-20926335 TACTTTTGAGAAACTGCTCTGGG + Intronic
1181367437 22:22388946-22388968 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1181420653 22:22795829-22795851 TGCTTTTGAGAGACAGCTGTTGG + Intronic
1182144204 22:27987135-27987157 GCCTTTTGACATACAGCTCGGGG - Intronic
1182954031 22:34404235-34404257 TCCATTTCAGAGGCAGTTCTAGG + Intergenic
1184456990 22:44616455-44616477 TCCTGTTGAGAAACTGCTCAAGG - Intergenic
1184603562 22:45558377-45558399 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1184638698 22:45857042-45857064 TCCTTTCGAGAAACAGCCCTTGG - Intergenic
1185033675 22:48459539-48459561 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
949170041 3:986606-986628 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
949245867 3:1924920-1924942 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
949417593 3:3830885-3830907 TCCTTTTGAGAGACAGCTCTTGG - Intronic
949445610 3:4131051-4131073 TCCTTTTGAGAGACAGCTCTTGG + Intronic
949751317 3:7355560-7355582 TCCTTTAGAGAGACAGCTTTTGG + Intronic
949905874 3:8858055-8858077 CCCTTCTGAGAAACAGCTCTTGG + Intronic
950825991 3:15821925-15821947 TGCTTTTGACAGACACCACTGGG - Intronic
950950523 3:16993412-16993434 ACCTTTGGAGAGAGAGCACTGGG - Intronic
951003618 3:17592849-17592871 TCCTTTTGAGAGACAGCTTTTGG + Intronic
951122570 3:18945564-18945586 TCCTTTTGAGAGGCAGCTCTAGG + Intergenic
951291520 3:20876748-20876770 TCCTTTTGTGAGACAGCACTTGG - Intergenic
951384524 3:22027532-22027554 TCCTTTTGAGAGACAGCTCTTGG + Intronic
951571102 3:24064193-24064215 TCCTTTTGAGAAATGGCTCTTGG - Intergenic
951970764 3:28441868-28441890 TCCTTTTGAGAGACAGCTCTTGG - Intronic
951978820 3:28543633-28543655 TCCTTTTGGGAAATACCTCTTGG + Intergenic
952605446 3:35142018-35142040 TCCTTTTCTGAGACAGCCCTTGG - Intergenic
954054155 3:48007957-48007979 TCCTTTTGAGAGTCAGCTCTTGG + Intronic
954511492 3:51129664-51129686 TCCTTTTGAGAGGCAGCTCTTGG - Intronic
955567947 3:60269970-60269992 TCATTTTCAGAGAAAGCTATGGG - Intronic
955591183 3:60537639-60537661 TCCTTTTGAGGGAAAGCCATGGG + Intronic
956306875 3:67835619-67835641 TCCTTTCGAGAGACGGTTCTTGG + Intergenic
956360451 3:68441435-68441457 TCCTTTTGAGAGATAGCTCTTGG + Intronic
956509660 3:69980369-69980391 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
956680195 3:71772052-71772074 TCCTCTTGAGTGACAGGTTTAGG + Intronic
956703896 3:71982890-71982912 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
957247582 3:77733900-77733922 TACTTTTGAGAGACAGCTTTTGG - Intergenic
957298500 3:78361646-78361668 CCCTTTTAAGAAACAGCTCTTGG - Intergenic
957315487 3:78570663-78570685 GCCTTTTGAAAAACAGCTTTAGG + Intergenic
957491913 3:80938552-80938574 TCTTTTTTAGAAACAGCTCTTGG - Intergenic
957754596 3:84469423-84469445 TCCTTCTCTGAGACAGCTCTTGG + Intergenic
957952318 3:87142086-87142108 GCCTTTTAAGAGACAGGGCTAGG - Intergenic
958025189 3:88041104-88041126 TGTTTTTGAGAAATAGCTCTTGG - Intergenic
958179875 3:90046485-90046507 TCCTTTTGAGAAACAGTTTTTGG - Intergenic
958424228 3:93963170-93963192 TTCTTTTGAGAAACTGCTCTTGG + Intronic
958487679 3:94732477-94732499 TCCTTTTAAGAGACAGCTCTTGG - Intergenic
958667682 3:97161238-97161260 CCCCTTTGAGAAACAGCTTTTGG - Intronic
959203652 3:103279248-103279270 TCCTTTTGAGAAATGGCTCTTGG - Intergenic
959226780 3:103597279-103597301 TCCTTTTAAGAGACAGCTTTTGG - Intergenic
959377345 3:105602837-105602859 TCCTTTTGAAAGACAGCTCTTGG - Intergenic
959439508 3:106359179-106359201 TCCTTTTGAGAGACAACGCTTGG + Intergenic
959746015 3:109777276-109777298 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
959967433 3:112372951-112372973 TCCTTTTGAGAAACAGCTTTTGG - Intergenic
960349528 3:116575698-116575720 TCCTTTTGAGAGACAGCTCTTGG + Intronic
960494747 3:118360783-118360805 TCCTTTTGAGAGACTGCTCTTGG - Intergenic
960842699 3:121976473-121976495 TCATTTTGAGAGATAGCATTTGG - Intergenic
961262847 3:125616420-125616442 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
961710980 3:128828005-128828027 TCCTTTCGAGAGACAGCTCTTGG - Intergenic
962972570 3:140417618-140417640 TCCTTTGGAGAAATAGCTCCAGG + Intronic
963319189 3:143794594-143794616 TCCTTTAGAAAGAAAACTCTTGG + Intronic
963331818 3:143923376-143923398 TCCTTTTGAGAGACAGATCTTGG - Intergenic
963355664 3:144206863-144206885 TGCTCCTGAGAAACAGCTCTTGG - Intergenic
963453670 3:145516664-145516686 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
963630308 3:147723217-147723239 TCCTTTTGAGAGACATCTTCTGG + Intergenic
964548474 3:157860711-157860733 TCCTTTTGAGAGTCAATCCTTGG + Intergenic
964679246 3:159318917-159318939 TCCTTTTGAGAGACAGCTCATGG - Intronic
965226768 3:166000767-166000789 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
965251333 3:166348270-166348292 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
965708645 3:171534782-171534804 TCCTTTTGAGAAGCAGCTCTTGG - Intergenic
965893155 3:173540097-173540119 TTCTTCTGAGAAACAGCTCTGGG - Intronic
966044331 3:175530924-175530946 TCCTTTTGAGAGACAGCTCTTGG - Intronic
966445692 3:179998556-179998578 TCCTTTTGAGAGACAGCTCTTGG + Intronic
966480569 3:180403963-180403985 TTCTTTTGAGAAATAACTCTTGG + Intergenic
966763532 3:183438039-183438061 TCATTTTGAGAAACAGCTCTTGG + Intergenic
966896734 3:184450563-184450585 TCCTTTTGAGAAACGGCTCCTGG - Intronic
966984949 3:185171796-185171818 TCCTTCTCAGGCACAGCTCTGGG - Intergenic
967570882 3:191027040-191027062 TCCTTTTAAGAAACTGCTTTTGG - Intergenic
967831775 3:193925987-193926009 CCCTTTCAAGAGACAGCTCTTGG + Intergenic
968800182 4:2738118-2738140 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
968906945 4:3457964-3457986 TCCTTTTGAAAGACAGCTCTTGG + Intergenic
969078558 4:4600405-4600427 TCTTTTTGAGTGACAGGACTTGG - Intergenic
969135684 4:5026841-5026863 TCCTTGTCAAAGACAGCTATTGG - Intergenic
969282440 4:6179706-6179728 TTCTTTTGAGTGGCAGCTCTTGG - Intronic
969407872 4:7006958-7006980 TCCTCTTGAGATACATGTCTCGG + Intronic
970254712 4:14155317-14155339 CCCTTTAGAGAAACAGATCTGGG + Intergenic
970526611 4:16938912-16938934 TCCTTTAGAGAGATAGTTCAGGG + Intergenic
970816402 4:20161301-20161323 TCCTTTAGAGAGACAGCTTTTGG + Intergenic
970941616 4:21640971-21640993 TCCTTTTGAGAAACTGCTTTTGG + Intronic
971370339 4:26014119-26014141 TGCTTTTGAGAGGGAGCACTCGG + Intergenic
971460485 4:26890522-26890544 TCCTTTTGAGAAACAGATTTTGG - Intronic
971897539 4:32617002-32617024 TCCTTTTGAGTGACAGCTCTTGG + Intergenic
971979296 4:33732876-33732898 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
972070405 4:35012366-35012388 TCTTTTTGAGAGACAGAGATAGG - Intergenic
972085222 4:35207110-35207132 CTCCTTTGAGAGACAGCTCCTGG + Intergenic
972094048 4:35326091-35326113 TCTTTTTGAGACACAACTCTTGG + Intergenic
972095492 4:35342686-35342708 TCCTTTTGAGAGAATGCTCTTGG + Intergenic
972805915 4:42529324-42529346 TCCTTTTGAGAGACAGCTCTTGG + Intronic
972842711 4:42950150-42950172 TCCCTTTAAGAGAGAGCACTGGG + Intronic
973098051 4:46226757-46226779 ACCTTTTGAGAGACAGCTCTTGG + Intergenic
973102924 4:46294749-46294771 TTTTTTTGAGAGACAGCTCTTGG + Intronic
973118441 4:46489040-46489062 TCCTTTTGAGAGGCAGCTCTTGG + Intergenic
973120981 4:46520901-46520923 TTCTTTTGAAATACAGCTCTTGG - Intergenic
973130191 4:46639698-46639720 TCCTTTTGAGAGATAGCCCTTGG - Intergenic
973143680 4:46798603-46798625 TCCTTTTGAAAAATAGCTCTTGG + Intronic
973584756 4:52378378-52378400 GCCTCTTGAGTGACATCTCTAGG + Intergenic
974262372 4:59542272-59542294 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
974289569 4:59912739-59912761 TTCTTTTGAGAAATAGCTCTTGG + Intergenic
974557604 4:63471896-63471918 TCCTTTTGAGAGTTAGCTCTTGG + Intergenic
974644616 4:64674767-64674789 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
974688527 4:65265587-65265609 TCCTTTTGAAAAACAGTTTTTGG + Intergenic
974746915 4:66088908-66088930 TCATTTTGAGAGACAGCTCTTGG - Intergenic
975024467 4:69531629-69531651 TCCTTTTGAGAGACAGCTCATGG + Intergenic
975051322 4:69868198-69868220 TCCTTTTGAGAGACAGATCTTGG + Intergenic
975386717 4:73767512-73767534 TTCTTTTGAGAGACAGCTTTTGG - Intergenic
975620752 4:76293977-76293999 TCCTTTTGAGAAACAGATTTTGG - Intronic
975982616 4:80177280-80177302 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
976893828 4:90083569-90083591 ACCTTTTGAAAAACAGCTCTGGG - Intergenic
977061181 4:92258557-92258579 TCTTTGTGATAGACAGTTCTTGG - Intergenic
977204715 4:94155681-94155703 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
977384912 4:96326533-96326555 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
977430766 4:96928209-96928231 TCTTTTTGAGAGACAGCTTTTGG + Intergenic
977466000 4:97383371-97383393 TCCTTTTGAGAGACAACTCTTGG + Intronic
977490072 4:97700074-97700096 TCCTTTTGAGGGACAGCTCTTGG - Intronic
977626277 4:99192657-99192679 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
977701732 4:100029890-100029912 TCCTTTTGAGTGACAGCTCTTGG - Intergenic
977833276 4:101618171-101618193 TCCTTTTGAAAGACAGCTCTTGG - Intronic
977847095 4:101779224-101779246 TCTTTTTGAGAAACAGTTCTTGG - Intronic
977930413 4:102743822-102743844 TCCTTTTGAGAGACAGCTCTTGG - Intronic
977976564 4:103273330-103273352 TCCTTTTGAGAAACGGCTCCTGG - Intergenic
978341591 4:107725552-107725574 TCCTTTTGAGAGACAGCTTGTGG - Intergenic
978772153 4:112467783-112467805 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
978899076 4:113926821-113926843 TCCTTTTGAGGGACAGCTCTTGG - Intronic
978918653 4:114154536-114154558 CTCTTTTGAGAAACAGCTCTTGG + Intergenic
979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG + Intergenic
979888568 4:126062176-126062198 TTCTTTTGAGAGATAGCTCTTGG - Intergenic
979898403 4:126189060-126189082 TCCTTTTGAGAGAAAGCTCTTGG - Intergenic
980101579 4:128546722-128546744 TCTTTTTCAGAGGCATCTCTAGG + Intergenic
980262441 4:130468526-130468548 ATCTTTTGAGAGACAGCTCCTGG + Intergenic
980387948 4:132111184-132111206 TCCTTTTGAGAGACAACACTTGG - Intergenic
980405892 4:132353794-132353816 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
980497527 4:133605365-133605387 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
980602159 4:135039517-135039539 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
980629522 4:135414283-135414305 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
980697745 4:136381734-136381756 TCCTTTTGGAAAACAGATCTTGG + Intergenic
980957730 4:139445914-139445936 TCCTTCTGAGAGACAGCTTTTGG + Intergenic
981835002 4:149043942-149043964 TCCTGTTGAGAGACAGCTCTTGG + Intergenic
981873538 4:149515193-149515215 TTTTTTTGAGAGGCAGCTCTTGG + Intergenic
981979356 4:150772607-150772629 TCCTTTTGAGAAACAACTCTTGG - Intronic
982597776 4:157407029-157407051 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
982623342 4:157732904-157732926 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
982835538 4:160116638-160116660 TCCTTTTGAGAGAGAGCTCTTGG + Intergenic
982847768 4:160274293-160274315 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
983027389 4:162755292-162755314 TCCTTTTTAGAGACAGCTCTTGG + Intergenic
983131541 4:164025784-164025806 TTCTTTTGAGAAAAAACTCTTGG - Intronic
983185063 4:164691572-164691594 TCCTTTCGAGAGACAGCTCTTGG + Intergenic
983515625 4:168653510-168653532 TCCTTATGACAGACAGTTCTTGG + Intronic
983582675 4:169324809-169324831 TTCTTTTAAGAGACAGCTCTTGG + Intergenic
983742355 4:171151255-171151277 ACCTTTTAAGAAACAGCTTTTGG - Intergenic
984060285 4:174982027-174982049 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
986037034 5:3950440-3950462 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
986087108 5:4462715-4462737 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
986742918 5:10719503-10719525 TCCTTTTGAGAGACAGCTCTTGG + Intronic
986938332 5:12918753-12918775 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
987149502 5:15024335-15024357 TCCTTTTGAAAAACAGCTTCTGG - Intergenic
987153175 5:15061663-15061685 CCCTTTTGAGAAACAGCTCTTGG + Intergenic
987468190 5:18296987-18297009 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
987504386 5:18749851-18749873 TCCTTTTGAGAGACAACTCTTGG + Intergenic
987578342 5:19758314-19758336 TCCTTTTGAGAGGCAGCTCTTGG - Intronic
987646375 5:20677332-20677354 ACCTTGTGAGAGACAGAACTTGG - Intergenic
987657138 5:20821654-20821676 TCTTTTTGAGAGACAGGTCTTGG - Intergenic
987780911 5:22434068-22434090 TCCTTTTGAGAACCAGTTATTGG - Intronic
987885443 5:23806497-23806519 TCCTTTTGAGAGATGGCTGTTGG + Intergenic
987967646 5:24896338-24896360 TCTTTTTGAGAGATAGGTCTTGG + Intergenic
988056569 5:26105270-26105292 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
988079832 5:26401422-26401444 TCCTTTTGAGAGACAACTCTTGG - Intergenic
988107757 5:26772544-26772566 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
988157486 5:27473680-27473702 TCCCTTTAAGAGACAGGGCTAGG - Intergenic
988160826 5:27516873-27516895 TCCTTTTGAGAGACAGATCTAGG - Intergenic
988169203 5:27632840-27632862 TCCTTTTGAAAGTCAGCTTTTGG - Intergenic
988188774 5:27901234-27901256 TCCTTTTAAGAGACAGCTCTTGG + Intergenic
988228768 5:28448124-28448146 TCATTTCAAGAGACAGCTCATGG + Intergenic
988562129 5:32290845-32290867 TCCTTTTGAAAGACAGCTCTTGG + Intronic
988766413 5:34382294-34382316 TCTTTTTGAGAGACAGGTCTTGG + Intergenic
989045207 5:37267593-37267615 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
989097830 5:37797318-37797340 ACCTTTTGAGAGACAGCTTTTGG + Intergenic
989257010 5:39376895-39376917 TCCTTGGGAGGGCCAGCTCTGGG + Exonic
989457642 5:41661770-41661792 TTCTTTTGAGGGACAGCTCTTGG - Intergenic
989486385 5:41996361-41996383 TCCTTTTGAGTGACAGCTCTTGG - Intergenic
989645854 5:43631916-43631938 GCCTTTTGAGGGTGAGCTCTGGG - Intronic
989679027 5:44007551-44007573 TGCTTTTGAGAAACAGCTCTTGG - Intergenic
989862498 5:46396774-46396796 TCCTTTTGATAGAGAAGTCTTGG + Intergenic
990748322 5:58983545-58983567 TCCTTTTGAAAGAAAGATATAGG - Intronic
991013808 5:61910902-61910924 TCCTTTTGAGAGACAGCCCTTGG - Intergenic
991033544 5:62105920-62105942 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
991234166 5:64375161-64375183 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
991330739 5:65489686-65489708 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
991579354 5:68138004-68138026 TTCTTTTTAGAGCCAGCTCTCGG + Intergenic
991946145 5:71900139-71900161 TTTTTTTGAGAGACAGCTGTTGG + Intergenic
992242954 5:74789865-74789887 TCCTTTTGAGAAACAGTTCTTGG + Intronic
993231902 5:85247535-85247557 TCCTTTTAAGAGACAGCTCTTGG - Intergenic
993319826 5:86458576-86458598 TCTTTTTGAGAGATAGCTCTTGG + Intergenic
993367469 5:87050958-87050980 TCCTTTTGACACACAGCTATTGG - Intergenic
993412582 5:87591814-87591836 TTCTTTTGAGAGGAAGCTCTTGG - Intergenic
993516983 5:88849879-88849901 GCCTTTTGAGAGGAAGGTCTAGG - Intronic
993787752 5:92164836-92164858 TCCTTTTGAGAAATAGCTTTTGG - Intergenic
993791790 5:92218909-92218931 TCCTTTTGAAAGACAGTTCTTGG + Intergenic
994291375 5:98031973-98031995 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
994539521 5:101076926-101076948 TCCTTTTGAGGAGCAACTCTTGG + Intergenic
994855436 5:105113586-105113608 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
994984421 5:106915731-106915753 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
995269558 5:110205468-110205490 TCCTTTTGAGATATAGCTCTTGG - Intergenic
995427734 5:112043728-112043750 TCCTTTTGAGACAAAGCTCTTGG - Intergenic
995776287 5:115727681-115727703 TCTTCTTGAGAGACAGCTCTTGG - Intergenic
996018559 5:118567854-118567876 TCCTCTAGAGAGACAGCTCTTGG + Intergenic
996164957 5:120212510-120212532 TCCTTTTGCGAGACAGCTTTTGG - Intergenic
996392203 5:122973787-122973809 TCCTTTTGAGAGACAGCTCTTGG - Intronic
996825562 5:127677833-127677855 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
996912232 5:128668972-128668994 TTCTTTCGGGAAACAGCTCTTGG + Intronic
997179409 5:131812882-131812904 CTCTTTTGAGAAACAGCTTTTGG + Intronic
998290337 5:140908553-140908575 TCCTTTTGAGAGACAGCTCTTGG - Intronic
998631320 5:143901708-143901730 TCCTTTTGACAGACAAATCTGGG - Intergenic
998970981 5:147592405-147592427 ACCTTTTCAGGGACATCTCTGGG - Intronic
999351384 5:150874843-150874865 TCCTTTTGAGAGACAGCTCTTGG + Intronic
999865670 5:155697991-155698013 TCTTTTTGAGAAACAGCTTCTGG + Intergenic
999960166 5:156746280-156746302 TCCTTTTGTGAGAGAGATTTTGG - Intronic
1000223246 5:159234250-159234272 TCCTTTTGAGACACAGCTCTTGG - Intergenic
1000416972 5:160993900-160993922 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1000587069 5:163113362-163113384 TCCTTTAGAAAGACATCCCTGGG + Intergenic
1000621619 5:163492940-163492962 CTCTTTTGAGAAACAGCTCTGGG - Intergenic
1000701052 5:164450777-164450799 TGCTTTTGAGAAACAGCCCAAGG + Intergenic
1001173594 5:169444641-169444663 TCCTTTTGAAAGACAGCTCTTGG + Intergenic
1001838824 5:174855734-174855756 TCCTTTTGGGAAGCAGCTTTTGG + Intergenic
1003023139 6:2529485-2529507 ACCTCGTGAGAGACAGCTCTTGG + Intergenic
1003051505 6:2784923-2784945 CCCTTCTGATACACAGCTCTAGG - Intronic
1003469921 6:6420076-6420098 TCCTTTTGAAAGTCAGTTCTTGG - Intergenic
1003695899 6:8406141-8406163 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1003758606 6:9150080-9150102 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1003766177 6:9239564-9239586 TTCTATTGACAGACAGGTCTGGG - Intergenic
1003791219 6:9549990-9550012 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1004298587 6:14436671-14436693 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
1004563764 6:16776433-16776455 TCCTTTTGGAAGACAGCTTTAGG + Intergenic
1004821538 6:19373189-19373211 ACCTTTTGAGAAACAGCTCCTGG + Intergenic
1004824289 6:19403237-19403259 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1004880981 6:20008267-20008289 TCCTTTGGAGGGTCATCTCTAGG + Intergenic
1004945046 6:20603206-20603228 TTCTTTTGAGAAACAGTTCCTGG + Intronic
1005185167 6:23157071-23157093 TCCTTTTGAGAGACAGCTGTTGG + Intergenic
1005300151 6:24462628-24462650 ATCTGTTGAGAGACAGCTGTAGG - Intronic
1005430855 6:25755387-25755409 TCCTTATGAGAAACAGCCCATGG - Intronic
1005661222 6:28001319-28001341 TCCTTTTGAGACGCAGCGCAGGG + Intergenic
1006001555 6:30969074-30969096 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1007225321 6:40309676-40309698 TCCTTTTGACAACCAGCTCTTGG + Intergenic
1008266923 6:49439290-49439312 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1008400291 6:51055470-51055492 TCCTTTTGAGAAACAGTTCTTGG + Intergenic
1008820397 6:55625151-55625173 TCCTTTTGAGAGATAGCTCCTGG + Intergenic
1009390112 6:63135079-63135101 TCTTTTTGAGAGACAGCTTTTGG - Intergenic
1009563203 6:65275240-65275262 TCCTTTTGAGAAACAGCTGTTGG + Intronic
1009660696 6:66606923-66606945 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1009770335 6:68136853-68136875 TCCTTTAGAGAGATAGCTCTTGG - Intergenic
1009806494 6:68606951-68606973 TGCTTTTGAAAGACAGCTCCCGG + Intergenic
1009851926 6:69208959-69208981 TCCTTTTGAGAGACAACTCTTGG - Intronic
1010028471 6:71246347-71246369 TCCTGGTGAGAAACAGCTCCTGG - Intergenic
1010323576 6:74540488-74540510 TCCTTTTGAGAGACACCTCTTGG + Intergenic
1010325331 6:74556600-74556622 TCCTTTTGAAAGACATCTCTTGG - Intergenic
1010404008 6:75481991-75482013 TCCTTTTGAGAGAAAGATTAGGG - Intronic
1010580754 6:77593906-77593928 CCCTTTTGAGAGACAGCTCTTGG - Intergenic
1010818631 6:80388399-80388421 TCCTTTTGAGAGACAGCTCCTGG + Intergenic
1010854104 6:80815418-80815440 TCCTTTTTAGAGACATCTCTTGG - Intergenic
1010938246 6:81886418-81886440 TGCTTTTGAGAGACAGCTCTTGG - Intergenic
1011069100 6:83361664-83361686 TCCTTTTGAGAGACAGCTCCTGG + Intronic
1012344587 6:98170318-98170340 TCCTTTTGAGAGATAGCTGTTGG + Intergenic
1012362991 6:98406686-98406708 CTCTTTCGAGAAACAGCTCTTGG - Intergenic
1012730460 6:102874318-102874340 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1012820802 6:104082917-104082939 TCCCTTTCAGAAACAGTTCTTGG + Intergenic
1012920795 6:105219546-105219568 TCATTTTGAGAGACAGCTCTTGG - Intergenic
1012960724 6:105618950-105618972 TCCCTATAAGAGACAGCCCTAGG - Intergenic
1013170906 6:107635412-107635434 TCCTTTTGAGCGGCGGCTCCAGG - Exonic
1013406670 6:109849801-109849823 TCCTTTTGAGAGACAGTTCTTGG + Intergenic
1013564267 6:111341783-111341805 TCCTTATGAGTGATAGCTCAAGG + Intronic
1014363398 6:120508355-120508377 TCCTTTTGAGAGAGAGCTCTTGG - Intergenic
1014416986 6:121195388-121195410 TACTTCTGAGAGACAGCTCTTGG + Intronic
1014534198 6:122596623-122596645 TCCTTTTGAGAGAGAGCTCTTGG - Intronic
1014698299 6:124651728-124651750 TGATTTTGGGAGACAGGTCTAGG - Intronic
1014895654 6:126896573-126896595 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1015095451 6:129409602-129409624 TCCATTTGAGAGACAACTCTTGG - Intronic
1015378917 6:132544526-132544548 ACCTTTTGAAAGATAGCTCTTGG - Intergenic
1015443286 6:133272566-133272588 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1015475748 6:133657490-133657512 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1015567174 6:134585685-134585707 TCCTTTAGAAACCCAGCTCTAGG - Intergenic
1015862092 6:137691840-137691862 TCCTTTTAAGAGACAGCTTTTGG + Intergenic
1016119916 6:140332693-140332715 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
1016144289 6:140649401-140649423 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1016147331 6:140692717-140692739 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1016174916 6:141069096-141069118 TCCTTTTGAAAGACAGTTCTTGG - Intergenic
1016419615 6:143870683-143870705 TTCTTTTGAGAGACAGCTCTTGG - Intronic
1016576259 6:145572588-145572610 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1016594550 6:145784879-145784901 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1016989242 6:149918167-149918189 TCCTTTGGAGTGACAGGTATGGG - Exonic
1017044070 6:150330855-150330877 TCGTTTTGAGAAACAGCTCTTGG - Intergenic
1017227806 6:152041093-152041115 TCCTTGTGAGAGACAACTCTTGG - Intronic
1017388457 6:153912208-153912230 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1017819838 6:158041296-158041318 TCATTTTGACAGAGGGCTCTTGG - Intronic
1017977117 6:159368058-159368080 TCCTTTTGGGAGACAGTTCTTGG - Intergenic
1018122929 6:160655224-160655246 TCCTTTTGAGAGACAGCTATTGG - Intronic
1018534387 6:164804998-164805020 TCCTTTTGAGACATTTCTCTTGG + Intergenic
1018535032 6:164810495-164810517 TCCTTTAGAGAGACCACTCTTGG - Intergenic
1018599885 6:165527525-165527547 TCCTTTTGAGAGACAGCTATTGG + Intronic
1018803793 6:167242992-167243014 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1020396716 7:7725513-7725535 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1020563249 7:9759026-9759048 TACTTTTGATAGATAGCTTTTGG + Intergenic
1020710348 7:11597624-11597646 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1021172006 7:17409119-17409141 TGCTTTTGAGACACAGTGCTTGG + Intergenic
1021305093 7:19022528-19022550 TCCTTTTGAGAAATAGCTCTTGG - Intronic
1021372064 7:19861435-19861457 TCCTTTTGAGAATCAGCTCATGG - Intergenic
1021988808 7:26122921-26122943 TCCTTTTGAGTGACAGCTCTTGG + Intergenic
1022078885 7:27000327-27000349 TCTTTTTGAGACACAGCTATTGG + Intergenic
1022689419 7:32632248-32632270 TCATTTTAACAGACAGCTCCTGG + Intergenic
1022916996 7:34966599-34966621 TCATTTTAACAGACAGCTCCTGG + Intronic
1022938119 7:35202221-35202243 TTCATCTGAGGGACAGCTCTTGG - Intergenic
1024040536 7:45550143-45550165 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1024486834 7:49928861-49928883 TCCTTTTGAGAAACAGCTTTTGG - Intronic
1024744206 7:52388442-52388464 CCTTTTTGAGAGACAGCTCTTGG + Intergenic
1024866102 7:53906342-53906364 TCCTTTTGAGAGACAGTTCTTGG + Intergenic
1027287429 7:76661555-76661577 TAATTTTCAGAGACATCTCTAGG + Intergenic
1027685796 7:81277953-81277975 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1028043860 7:86091464-86091486 TACTTTTGAAAGATAGTTCTTGG + Intergenic
1028141734 7:87281982-87282004 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1028213405 7:88102364-88102386 TACTTCTGAGAGTCAGTTCTGGG + Intronic
1028237819 7:88382819-88382841 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1028880375 7:95873190-95873212 TCCCTTTGAGAGAGATGTCTTGG - Intronic
1028935012 7:96455061-96455083 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1030277457 7:107736112-107736134 TCCTTTTGAGAGACATATCTTGG + Intergenic
1030368752 7:108674025-108674047 TCCTTTTGAGAGACAGATCTTGG + Intergenic
1030457464 7:109793054-109793076 GTCTTTTGAGTGACAACTCTTGG - Intergenic
1030550931 7:110958751-110958773 ACCCTTTGAGATACAGATCTAGG - Intronic
1030931289 7:115525685-115525707 GCCTTTTGAGAGACAGCTCTTGG - Intergenic
1031236825 7:119188013-119188035 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1031474447 7:122205355-122205377 TTCTTTTGAGAGACAGACCTTGG - Intergenic
1031676557 7:124618362-124618384 TTTTTTTGAGAGACAGCTCTTGG + Intergenic
1031761418 7:125717115-125717137 TCTTTTTGAGAGACAGCTTTTGG + Intergenic
1031767823 7:125803696-125803718 TCCTTTTGAAAGGCAGCTTTTGG + Intergenic
1032153105 7:129446960-129446982 TACTTTTGAGAGACAGCTCTTGG - Intronic
1032923472 7:136576118-136576140 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1033076256 7:138253043-138253065 TCCTTTTGAGAGGCAGCTCTTGG + Intergenic
1034357256 7:150460942-150460964 ACCTTTTGAGAAACAGCTTTTGG - Intronic
1036637718 8:10563533-10563555 TCCCCTCCAGAGACAGCTCTAGG + Intergenic
1037364594 8:18108272-18108294 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1037766068 8:21773073-21773095 TCCTTCTGAGACAGTGCTCTGGG - Intronic
1037953616 8:23036099-23036121 TCCTTTTGAGAAACAGCTCTTGG + Intronic
1038082669 8:24157198-24157220 TTCTTTTGAGAAACAGCACATGG + Intergenic
1039324172 8:36466528-36466550 TCCTTTGGAGAGATAGCCCTTGG - Intergenic
1039626544 8:39060155-39060177 TCCTTTTGAGAAAAAACTATTGG - Intronic
1040711011 8:50188770-50188792 TGCTTTTGAGAAACAGATTTTGG - Intronic
1040724964 8:50371142-50371164 TTCTTTTGAGAATCAGCTATTGG + Intronic
1040911945 8:52528415-52528437 TGCTTTTGAGAGACAGCTCTTGG + Intergenic
1041478511 8:58292438-58292460 GCCTTTTGATAAACAGCTCCAGG - Intergenic
1041934552 8:63321327-63321349 TCCTTTTGAGAGACAGCTCTCGG + Intergenic
1041986181 8:63924470-63924492 TCTTTTTGAGAGATAGCTCTTGG + Intergenic
1042001063 8:64123999-64124021 TCCTTTTGGGAGACAGCTCTTGG - Intergenic
1042342419 8:67694348-67694370 TCCTTCTGAGAGACAGCTCTTGG + Intronic
1043232517 8:77820906-77820928 TCCTTTTAAAAAACAGCTGTTGG - Intergenic
1044133755 8:88559031-88559053 CCCTTTTGAGAAACAGCTCTTGG + Intergenic
1044202388 8:89452485-89452507 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1044633156 8:94298409-94298431 TCCTTTTGAGAGGCAGCTCTTGG - Intergenic
1046128675 8:109941605-109941627 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1046197557 8:110884220-110884242 TCATTTTGAGGGACAGCTCTTGG + Intergenic
1046384812 8:113495454-113495476 TCCTTTTGATAAACAGCTCTTGG + Intergenic
1046417639 8:113937797-113937819 TCCTTTTGAGAGACAGGTCTTGG - Intergenic
1046585786 8:116147722-116147744 TTTTTTTAAGAGACAGCTCTTGG - Intergenic
1047414114 8:124649947-124649969 TCCTTTTAACAGACAGCAATTGG + Intronic
1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG + Intergenic
1048555560 8:135472456-135472478 TGCATTTCAGACACAGCTCTGGG - Intronic
1050482673 9:6102600-6102622 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1050698001 9:8300588-8300610 GCTTTTTGAGACACATCTCTGGG + Intergenic
1050817653 9:9835592-9835614 TTCTTTTGACAAATAGCTCTTGG + Intronic
1050888736 9:10796760-10796782 GTCTTTTGAGAGACAGATCATGG - Intergenic
1050934407 9:11376791-11376813 TTCTTTCTAGAGACAGTTCTTGG - Intergenic
1051882145 9:21850659-21850681 TCCTTTCGAGAGACTGTCCTTGG + Intronic
1052205423 9:25833645-25833667 TCCTTTAGAGAAACAGTTCCTGG - Intergenic
1052227588 9:26108373-26108395 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1052368649 9:27640833-27640855 TCCTTTTGAGAGACAGCCCTTGG + Intergenic
1052442271 9:28512285-28512307 TCCTTTTGAGAGTCAGCTCCTGG - Intronic
1053610818 9:39711426-39711448 TCCTTTTGAGAAACAACTCTTGG + Intergenic
1053868854 9:42469448-42469470 TCCTTTTGAGAAACAACTCTTGG + Intergenic
1054087436 9:60759732-60759754 TCCTTTTGAGAAACAACTCTTGG - Intergenic
1054242704 9:62630969-62630991 TCCTTTTGAGAAACAACTCTTGG - Intergenic
1054556828 9:66665487-66665509 TCCTTTTGAGAAACAACTCTTGG - Intergenic
1055513515 9:77016665-77016687 TCCTTTTGGGGAGCAGCTCTGGG - Intergenic
1055903942 9:81271207-81271229 TCCTTTTGAGAGATACCTCTTGG - Intergenic
1056156665 9:83845206-83845228 TCCTTTTAAGAGACAGCTCTTGG + Intronic
1056275431 9:84990262-84990284 TCATGTTGAGAGCCAGCGCTTGG + Intronic
1056314235 9:85372948-85372970 TTCTTTTCAGAGACAGCTCTTGG - Intergenic
1056353873 9:85778321-85778343 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1056733329 9:89184058-89184080 TCCTATTATGAGACAGCACTGGG - Intergenic
1057058995 9:91986587-91986609 TCCTTTTGAAAAACAGCTCTTGG + Intergenic
1057911238 9:99021947-99021969 TCCTTTGCAGAGACAGCTTAAGG - Intronic
1057966179 9:99505543-99505565 AACTTTTGAGAGACAGTACTTGG + Intergenic
1058019895 9:100076077-100076099 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1058259257 9:102809671-102809693 TCCTTTCGAGAGGTAGCACTTGG - Intergenic
1058544167 9:106042753-106042775 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1059370877 9:113833595-113833617 TGTTTTTGACAAACAGCTCTGGG - Intergenic
1059893368 9:118831667-118831689 ACCTTTTGAGAAATAGATCTTGG + Intergenic
1060178779 9:121517314-121517336 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1061011872 9:127960710-127960732 TCCTTTTGAGAGTTTGCTGTGGG + Intronic
1186279494 X:7977115-7977137 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1186384095 X:9091765-9091787 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1186469768 X:9812112-9812134 TCCTTTTGAGATAAAGCTCTTGG - Intronic
1187604864 X:20871859-20871881 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1189032442 X:37464283-37464305 TCCTTTTGAAAAATAGCCCTTGG - Intronic
1189154885 X:38746725-38746747 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
1189736235 X:44072538-44072560 TCCTGTTGAGAGAGGGCTGTTGG + Intergenic
1190255272 X:48757800-48757822 TCCTTTTGAGAAACAGCTCTTGG + Intergenic
1190527880 X:51346252-51346274 TCCTTTTGAGAAATAGCTCTTGG - Intergenic
1190601539 X:52097838-52097860 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1191009349 X:55744640-55744662 CCCTTTTGGGAAACAGTTCTTGG - Intronic
1191095707 X:56671178-56671200 TTCTTTTAAAAGACAGTTCTTGG - Intergenic
1191134035 X:57044491-57044513 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1191630039 X:63312592-63312614 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1191631293 X:63324875-63324897 TCATTTTGAGAGACAGCTTTTGG + Intergenic
1191658806 X:63629810-63629832 TCCTTTTTAAAGACAGCTCTTGG - Intergenic
1191742541 X:64451312-64451334 TCCTTTTGAGAAACAGCTATTGG - Intergenic
1191769496 X:64740102-64740124 TCCTTTTGAGGGACAGCTTTTGG - Intergenic
1191870025 X:65738013-65738035 TCCTCATGAGAGACAGGTCTTGG - Intronic
1191932925 X:66394159-66394181 TTTTTTTGAGAGACAGCTTTTGG + Intergenic
1191941262 X:66483869-66483891 TCTTTTTGAGAGACAGTCCTTGG - Intergenic
1191946352 X:66539007-66539029 TCCTTTTGAGAGACTGCTCTTGG + Intergenic
1192297712 X:69868020-69868042 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1192657638 X:73008976-73008998 CCCTTTTGAGAGACAATTCCTGG - Intergenic
1192661564 X:73047766-73047788 TCCTTTTGAGAAATAGCTCTTGG - Intergenic
1192673253 X:73168421-73168443 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
1192824485 X:74681190-74681212 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
1192898702 X:75471905-75471927 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1192996191 X:76515573-76515595 TCCTTTTCAGAAACAGCTCTTGG + Intergenic
1193053489 X:77125763-77125785 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1193297779 X:79852669-79852691 TCCTTTTGAGAAACAGTTCTTGG + Intergenic
1193447155 X:81618766-81618788 TTCCTTTGAGAGACAGCTCTTGG + Intergenic
1193480231 X:82018627-82018649 TCCTTTGGAGTAAAAGCTCTTGG + Intergenic
1193573669 X:83174936-83174958 TCCTTTTTAGAGACAGCTCTTGG - Intergenic
1193876041 X:86863913-86863935 TTGTTTTGAGAAACAGCTTTTGG + Intergenic
1193914803 X:87351933-87351955 TCCATTTGAGAAACAGCTCTTGG - Intergenic
1193957283 X:87878205-87878227 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1194072287 X:89340617-89340639 TCCCTCTGAGATACAGCCCTTGG - Intergenic
1194155337 X:90380936-90380958 TCCTTTTGAGAAACAGTTCTTGG - Intergenic
1194179592 X:90695940-90695962 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1194210277 X:91062349-91062371 TCCTTTTGAGAGACTGCTCTTGG + Intergenic
1194343309 X:92731079-92731101 TCCTTTTGAGAGACAGCCGTTGG + Intergenic
1194443548 X:93961098-93961120 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1194482723 X:94446561-94446583 TCCTTTTCAGAGACAGCATTTGG + Intergenic
1194513419 X:94822257-94822279 TCCATTTGAGAGACAGCTCTTGG - Intergenic
1194589026 X:95773550-95773572 TATTTTTGAGAAACAACTCTGGG + Intergenic
1194604390 X:95961973-95961995 CTCTTTTGAGAGACAGCTTTTGG - Intergenic
1194626614 X:96233161-96233183 TCCTTTTGCAAGACAGTTCTTGG + Intergenic
1194698912 X:97090328-97090350 TTTTTTTGAGAAAGAGCTCTGGG + Intronic
1194833957 X:98658799-98658821 TCCTTTTGAGAGCGAGCTCTTGG + Intergenic
1194849247 X:98852179-98852201 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1195228468 X:102822266-102822288 TTCTTTTGAGAAACAGCTCTTGG + Intergenic
1195782354 X:108479870-108479892 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1195982618 X:110595834-110595856 ACCTTTTAAGAAACACCTCTTGG + Intergenic
1196135970 X:112209848-112209870 TCCTTTTGCAAGACAGCTCTTGG - Intergenic
1197002288 X:121452919-121452941 CCCTTTTGAGAGATAGCTCATGG + Intergenic
1197044413 X:121978320-121978342 CTCCTTTGAGAGACAACTCTTGG + Intergenic
1197084198 X:122453504-122453526 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
1197097467 X:122612833-122612855 TCCTTTTGAGAGACAGGTTTTGG + Intergenic
1197245047 X:124158999-124159021 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1197372057 X:125637871-125637893 TCCTTCTGAGAGGCAGCTCTTGG - Intergenic
1197386774 X:125812248-125812270 TCCTTTTGAGAACCGGCTCTTGG - Intergenic
1197405086 X:126039193-126039215 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1197477360 X:126941334-126941356 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1197521997 X:127510361-127510383 TACTCTTGAGAGGCAGCTCATGG + Intergenic
1197534716 X:127673474-127673496 TCTTTTTGAGAAAGAGCTGTTGG + Intergenic
1198170003 X:134096249-134096271 TGCTTTTGAGAAATTGCTCTTGG + Intergenic
1198701299 X:139400291-139400313 TCCTTTTGAGAGACGGCTCTTGG + Intergenic
1198783041 X:140257802-140257824 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1198934039 X:141887874-141887896 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1199021247 X:142881096-142881118 TTCTTTTGAAAAACAGCTCTTGG + Intergenic
1199024378 X:142919714-142919736 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1199040590 X:143111095-143111117 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1199144443 X:144348970-144348992 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1199310428 X:146314405-146314427 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1199573422 X:149290358-149290380 TTTTTCTGAGAGACAGCACTAGG - Intergenic
1200289355 X:154857134-154857156 TCCTTTTGTGAGATAGCTCTTGG + Intronic
1200501686 Y:3957869-3957891 TCCTTTTGAGAAACAGTTCTTGG - Intergenic
1200521269 Y:4212025-4212047 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1200526254 Y:4278109-4278131 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1200651668 Y:5847744-5847766 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1200726529 Y:6676368-6676390 TCCCTCTGAGATACAGCCCTTGG - Intergenic
1200727681 Y:6692144-6692166 TCCCTCTGAGATACAGCCCTTGG - Intergenic
1200746059 Y:6904877-6904899 TCCTTTTGAGCGATAGCTCTTGG - Intergenic
1200973124 Y:9177715-9177737 TGCTTTGGAGAGACAGCTCTTGG - Intergenic
1200976628 Y:9218475-9218497 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1201529653 Y:14977899-14977921 TCCTTTTGAGAGAAGGCTTTTGG - Intergenic
1201796630 Y:17903416-17903438 TTCTTTGGAGAGACAGCTCCTGG - Intergenic
1201798426 Y:17926694-17926716 TCCTATTGAGAGACAGCTCTTGG + Intergenic
1201803127 Y:17979263-17979285 TCCTATTGAGAGACAGCTCTTGG - Intergenic
1201804925 Y:18002569-18002591 TTCTTTGGAGAGACAGCTCCTGG + Intergenic
1202137954 Y:21686798-21686820 TGCTTTGGAGAGACAGCTCTTGG + Intergenic
1202358014 Y:24072478-24072500 TTCTTTGGAGAGACAGCTCTTGG - Intergenic
1202359746 Y:24095384-24095406 TCCTATTGAGAGACAACTCTTGG + Intergenic
1202511032 Y:25574730-25574752 TCCTATTGAGAGACAACTCTTGG - Intergenic
1202512764 Y:25597635-25597657 TTCTTTGGAGAGACAGCTCTTGG + Intergenic