ID: 1003791223

View in Genome Browser
Species Human (GRCh38)
Location 6:9550008-9550030
Sequence CTTGGCCTATTACTGGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003791217_1003791223 22 Left 1003791217 6:9549963-9549985 CCTACCATCTTCTGAAGATAACT No data
Right 1003791223 6:9550008-9550030 CTTGGCCTATTACTGGGATTTGG No data
1003791218_1003791223 18 Left 1003791218 6:9549967-9549989 CCATCTTCTGAAGATAACTACTC No data
Right 1003791223 6:9550008-9550030 CTTGGCCTATTACTGGGATTTGG No data
1003791220_1003791223 -6 Left 1003791220 6:9549991-9550013 CCTTTTGAGAGACAGCTCTTGGC 0: 173
1: 182
2: 165
3: 95
4: 236
Right 1003791223 6:9550008-9550030 CTTGGCCTATTACTGGGATTTGG No data
1003791216_1003791223 23 Left 1003791216 6:9549962-9549984 CCCTACCATCTTCTGAAGATAAC No data
Right 1003791223 6:9550008-9550030 CTTGGCCTATTACTGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003791223 Original CRISPR CTTGGCCTATTACTGGGATT TGG Intergenic
No off target data available for this crispr