ID: 1003798236

View in Genome Browser
Species Human (GRCh38)
Location 6:9630197-9630219
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003798233_1003798236 0 Left 1003798233 6:9630174-9630196 CCTAGTGACATGTTAAATTGTAA No data
Right 1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type