ID: 1003799685

View in Genome Browser
Species Human (GRCh38)
Location 6:9649694-9649716
Sequence TGAAGTCCACACTTTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003799684_1003799685 -6 Left 1003799684 6:9649677-9649699 CCTTGTGGTTGTAAGACTGAAGT 0: 2
1: 11
2: 62
3: 169
4: 431
Right 1003799685 6:9649694-9649716 TGAAGTCCACACTTTGTTCCTGG No data
1003799681_1003799685 28 Left 1003799681 6:9649643-9649665 CCACATTTATTCAGGTTTTTGAA 0: 1
1: 0
2: 2
3: 60
4: 500
Right 1003799685 6:9649694-9649716 TGAAGTCCACACTTTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003799685 Original CRISPR TGAAGTCCACACTTTGTTCC TGG Intronic
No off target data available for this crispr