ID: 1003800166

View in Genome Browser
Species Human (GRCh38)
Location 6:9655320-9655342
Sequence GGACCTTGATGAAGTCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003800166_1003800175 29 Left 1003800166 6:9655320-9655342 CCTGTAGGACTTCATCAAGGTCC No data
Right 1003800175 6:9655372-9655394 CAGGAGCAGGACTCACTCATGGG 0: 1
1: 0
2: 1
3: 18
4: 186
1003800166_1003800174 28 Left 1003800166 6:9655320-9655342 CCTGTAGGACTTCATCAAGGTCC No data
Right 1003800174 6:9655371-9655393 ACAGGAGCAGGACTCACTCATGG No data
1003800166_1003800170 16 Left 1003800166 6:9655320-9655342 CCTGTAGGACTTCATCAAGGTCC No data
Right 1003800170 6:9655359-9655381 CCTGATCCTCCCACAGGAGCAGG No data
1003800166_1003800168 10 Left 1003800166 6:9655320-9655342 CCTGTAGGACTTCATCAAGGTCC No data
Right 1003800168 6:9655353-9655375 TCTTCACCTGATCCTCCCACAGG 0: 1
1: 0
2: 0
3: 31
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003800166 Original CRISPR GGACCTTGATGAAGTCCTAC AGG (reversed) Intronic