ID: 1003803544

View in Genome Browser
Species Human (GRCh38)
Location 6:9699785-9699807
Sequence ATGGAGTAGCAGAAAGACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 356}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003803544_1003803550 13 Left 1003803544 6:9699785-9699807 CCGTGGTCTTTCTGCTACTCCAT 0: 1
1: 0
2: 2
3: 42
4: 356
Right 1003803550 6:9699821-9699843 GGAGTGTTTGTGGTTTGAATGGG No data
1003803544_1003803548 3 Left 1003803544 6:9699785-9699807 CCGTGGTCTTTCTGCTACTCCAT 0: 1
1: 0
2: 2
3: 42
4: 356
Right 1003803548 6:9699811-9699833 CGCTTCTAATGGAGTGTTTGTGG 0: 1
1: 0
2: 0
3: 3
4: 67
1003803544_1003803549 12 Left 1003803544 6:9699785-9699807 CCGTGGTCTTTCTGCTACTCCAT 0: 1
1: 0
2: 2
3: 42
4: 356
Right 1003803549 6:9699820-9699842 TGGAGTGTTTGTGGTTTGAATGG No data
1003803544_1003803546 -8 Left 1003803544 6:9699785-9699807 CCGTGGTCTTTCTGCTACTCCAT 0: 1
1: 0
2: 2
3: 42
4: 356
Right 1003803546 6:9699800-9699822 TACTCCATGGTCGCTTCTAATGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003803544 Original CRISPR ATGGAGTAGCAGAAAGACCA CGG (reversed) Intronic
900200240 1:1401471-1401493 ATCGGGGGGCAGAAAGACCAGGG + Intronic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
901902083 1:12373580-12373602 ATGCAAGAGCAGAAAGATCAGGG - Intronic
902613594 1:17611189-17611211 ATGGAGCACCAGAAGGCCCAGGG + Intronic
902837656 1:19057580-19057602 TTGGAGGAACAGAAAGGCCAGGG + Intergenic
902880058 1:19366125-19366147 AAGGAGTAGCAGCAAGACTTGGG + Intronic
903411898 1:23151509-23151531 ATAGAGGAGCAGAAAGAACATGG + Intronic
904492081 1:30867482-30867504 TTGGAGGAGTAGAAAGAGCATGG - Intergenic
906000944 1:42424451-42424473 AGGGAATAGCAGAAAGCCTAAGG - Intergenic
906841775 1:49147013-49147035 ATAGAGAAGCAGAAAAGCCAAGG + Intronic
907169644 1:52450774-52450796 ATGAAGTAATAGAAATACCAAGG - Intronic
907203382 1:52747455-52747477 ATGGTGTAGCAGAAAAAGTATGG + Intronic
907263694 1:53240916-53240938 ATGGTGTAACTGAAAGAGCATGG + Intergenic
907466507 1:54641377-54641399 GTGGAGTAGGAAAAAGATCAAGG + Intergenic
907829364 1:58049589-58049611 TTGGAATAGAAGAAAGAGCATGG + Intronic
908161537 1:61413489-61413511 ATGAGGTAGTAGAAAGAGCATGG - Intronic
908206538 1:61856082-61856104 ATGGTGTAGCAGAAAGAAGTGGG + Exonic
909582762 1:77256568-77256590 AGGGAGTAGAAGAAAGACTGGGG + Intergenic
911262972 1:95709274-95709296 GTGGAGTAGGAGGAAAACCAAGG + Intergenic
912063284 1:105701395-105701417 ATGCAGTAGGAGAAAAACTAAGG - Intergenic
912667742 1:111598143-111598165 ATGGTATAGCAGAAAGAACAGGG - Intronic
912801771 1:112723870-112723892 CTGGAGTAGGGGAAAGACAAGGG + Intronic
912811929 1:112801587-112801609 CTGGAGTAGCCAAAAGACCTGGG - Intergenic
915019864 1:152768998-152769020 ATGGAATAGCAGAGAGGACACGG + Intronic
915054920 1:153119383-153119405 CAGGAGAACCAGAAAGACCACGG + Intergenic
915444285 1:155966077-155966099 TTGGTGTAACAGAAAGAGCATGG - Intronic
916169713 1:161992677-161992699 AAGGAGTGGGAGAGAGACCAGGG + Intronic
918919070 1:190682362-190682384 ATGGCTGAGCAGAGAGACCAAGG + Intergenic
918996956 1:191773758-191773780 ATGGAGTTGCAGAAGACCCAGGG - Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919796668 1:201325214-201325236 ATGGAGTAGGGGAAGCACCAAGG + Intronic
921079222 1:211725388-211725410 AGGGAGTAGAAGCAAAACCATGG - Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923098503 1:230794069-230794091 AGGAAGAAGCAGAAAGACCCTGG + Intronic
923638051 1:235721241-235721263 ATGGTGTAGTAGAAACAGCACGG + Intronic
924526037 1:244850154-244850176 TTGGAGTAGATGAAAAACCAGGG - Intronic
1063264559 10:4433652-4433674 GAGGAGAAGGAGAAAGACCAGGG + Intergenic
1064818764 10:19299268-19299290 ATGGAGAAGCAGAATTCCCAAGG - Intronic
1065845967 10:29743644-29743666 ATGGAGAAGCAGATAAACTACGG - Intergenic
1067238533 10:44471598-44471620 ATGGAGTAGCACCCAGACCTTGG + Intergenic
1070014011 10:72506431-72506453 ATGATGTAGCAGAAAGACTATGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071710483 10:88044391-88044413 ATGGAGCAGCAGAGAGGCCTGGG - Intergenic
1071772605 10:88745948-88745970 ATGGAAAAGAAAAAAGACCAGGG + Intronic
1072931031 10:99662467-99662489 TGACAGTAGCAGAAAGACCAAGG - Intronic
1073515409 10:104071388-104071410 AAGGAGTAGAAGAAAGAACATGG - Intronic
1073707520 10:106001830-106001852 ATGGAGGAGGAGGAGGACCATGG + Intergenic
1073821911 10:107273840-107273862 ATGTGGTAGCAGAAAAAGCAAGG + Intergenic
1073899267 10:108201037-108201059 ATGGCATAGCAGAAAGAACATGG - Intergenic
1074368658 10:112880741-112880763 GAGGAATAGCAGAAAGAACATGG + Intergenic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1074967691 10:118506959-118506981 AGAGAGTAGCAGAAAGACTGAGG - Intergenic
1075401818 10:122166466-122166488 TTGGAGTAGCAGAAGTCCCATGG + Intronic
1076161654 10:128248257-128248279 ATGGAGTAGGAGGAAGAGCCTGG + Intergenic
1077738872 11:4822257-4822279 AGGGATTAGCAGAAAGACATTGG - Exonic
1077972762 11:7212546-7212568 ATTGAATAGCAGAGAGACAAGGG + Intergenic
1078242933 11:9546900-9546922 AGGGAGTAGAAGGAAGTCCAAGG + Intergenic
1078339975 11:10491673-10491695 AGGGAGTAGTAGGAAGGCCAAGG + Intronic
1078910523 11:15727032-15727054 CTGGCATAGTAGAAAGACCATGG - Intergenic
1079100112 11:17535908-17535930 GTGGCGTAGCAGAAAGAACATGG - Intronic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1085054550 11:73395946-73395968 AAGGGGTAGCAGAAAGTCCTGGG + Exonic
1085474306 11:76780253-76780275 GTGGTGTAGCAGAAAGGCCTGGG - Intergenic
1085916848 11:80900461-80900483 ATGGAGTTGCAGAGAGAGCAGGG + Intergenic
1086157657 11:83685503-83685525 GTGAAGTAGGAGAAAAACCAAGG - Intronic
1086610304 11:88748028-88748050 CTGGAGTAGCAGAGAGCCAAAGG + Intronic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1087009980 11:93504150-93504172 TTGGAGTTGCAGAAATATCATGG - Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087278104 11:96180584-96180606 ATGGAGCAGCTTACAGACCAAGG - Intronic
1087677330 11:101178224-101178246 ATGTGGTAGAAGAAAGAACATGG + Intergenic
1087750211 11:101998919-101998941 ATGGTGTGGCAGAAAGAACATGG - Exonic
1088035333 11:105305613-105305635 ATGGTGTAGAAGAAATACCATGG + Intergenic
1088312235 11:108472041-108472063 ATGCAGTTACAGAAATACCAGGG + Intergenic
1088641138 11:111874007-111874029 AGAAAGTAGCAGAAAGAACATGG + Intergenic
1089988428 11:122835302-122835324 AGTGAGTAGCAGACAGACCCAGG - Intergenic
1090051564 11:123384404-123384426 ATACAGCAGCACAAAGACCAAGG - Intergenic
1092316000 12:7414022-7414044 ATGGAAAAACAGAAACACCAAGG + Intronic
1092510844 12:9154635-9154657 ATGAAGCAGCAGAACGCCCAAGG - Exonic
1093699775 12:22206405-22206427 ATGGGGTAGCAGAGACACCCAGG + Intronic
1094081079 12:26536634-26536656 ATGGAGTAGCAGCAAGAACTGGG + Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095744999 12:45648225-45648247 ATGGAGTAACCGAAAGCACAAGG + Intergenic
1095910321 12:47419380-47419402 ATGGGGTAACTGGAAGACCAGGG - Intergenic
1097929022 12:65163975-65163997 ATGGTATAGTAGAAAGAACAAGG + Intergenic
1098609489 12:72437361-72437383 TTGGATTAGCAGAAATACAACGG - Intronic
1098622957 12:72627066-72627088 ATGGAATAGCAAAAAGAACAGGG + Intronic
1099116059 12:78625331-78625353 ATGTTGTAGCTGGAAGACCAAGG + Intergenic
1100509752 12:95258057-95258079 ATGCTATAGCAGAAAGAGCATGG - Intronic
1101358935 12:104008341-104008363 ATGTTTTAGCAAAAAGACCAGGG + Intronic
1102577007 12:113862056-113862078 AAGGAGGAGCTGAAAGATCAGGG + Intronic
1105646157 13:22320043-22320065 ATGGAGTAGCAGAACAATTAAGG - Intergenic
1105983812 13:25545952-25545974 ATGAAGTGGCAGACAGATCATGG + Intronic
1107947423 13:45431709-45431731 CTGGAGTAGCAAACAGAGCAGGG - Intergenic
1108328434 13:49359065-49359087 ATGGTGGAGTAGAAAGACAAGGG + Intronic
1108890703 13:55254799-55254821 ATAGACTACCACAAAGACCATGG + Intergenic
1109129068 13:58557641-58557663 GTGGAGTAACAGAAAGAAAATGG - Intergenic
1109364267 13:61335177-61335199 ATGAAGTAGTAGAAAGTTCAGGG + Intergenic
1110239059 13:73246905-73246927 ATGGAGTAGAAGTAAAAACAAGG + Intergenic
1110646946 13:77897610-77897632 AGGGAGTAACAGAAAGAGCAAGG - Exonic
1111170972 13:84526228-84526250 ATTGTGTAGCAGAAACACTAAGG - Intergenic
1111659286 13:91189498-91189520 ATGGAGTAACAGAGAGAGAAAGG + Intergenic
1112228794 13:97567399-97567421 AGGGAGTTGCAGAAATACCTGGG + Intergenic
1112320443 13:98402249-98402271 ATGGAAAAGCACACAGACCAAGG + Intronic
1112578461 13:100658264-100658286 CAGGAGTAGCAGAAAGGCAAAGG + Intronic
1113395308 13:109941920-109941942 AAGGAGAAGGAGGAAGACCAAGG - Intergenic
1113594520 13:111521561-111521583 CTGGAGGAGGAGAAAGACCCAGG + Intergenic
1113744710 13:112735891-112735913 ATGGAGGAGCACACGGACCATGG - Intronic
1115345835 14:32342587-32342609 AAAGAGCAGCAGAAAGATCATGG - Intronic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1117272238 14:54156816-54156838 ATGGGGGAGCAGTAAGACAAGGG - Intergenic
1118593378 14:67418290-67418312 GTGGAGTAGTGGAAAGAGCAAGG - Intergenic
1119439835 14:74620665-74620687 CTGGAGTAGTAGGAAGAACAAGG + Intergenic
1119601750 14:75981325-75981347 AAGAAGAAGCAGAAGGACCATGG + Intronic
1120073301 14:80127080-80127102 ATGGAATAACACAAAGCCCAGGG + Intergenic
1120228922 14:81821765-81821787 ATGGAGAAGCAGCTAGACAAAGG + Intergenic
1120404165 14:84073296-84073318 GTGGAGAGGCAGAAAGACAAGGG + Intergenic
1120689663 14:87578436-87578458 TGGAAGGAGCAGAAAGACCATGG - Intergenic
1121780575 14:96619361-96619383 ATGGAGATGCAGAAAGACAGTGG + Intergenic
1123661960 15:22572316-22572338 AGGGAGTTGCAGACAGATCAGGG + Intergenic
1124631208 15:31338692-31338714 GAGGAGGAGCAGAGAGACCAGGG - Intronic
1124899941 15:33813018-33813040 ATGGGGAAGCAGAAACACCCTGG + Intronic
1125194841 15:37034263-37034285 ATGGGGAAACAGAAAGTCCAGGG + Intronic
1127175508 15:56350946-56350968 ATGGAGTAGAAGAATGGCAATGG + Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128814402 15:70597013-70597035 ATTGTGTAGAAGACAGACCATGG - Intergenic
1129721878 15:77882033-77882055 ATGAAGGAGCAGAGGGACCAGGG - Intergenic
1130757763 15:86783982-86784004 TTGGAGTAGAAGTAAGAACATGG + Intronic
1131066103 15:89435876-89435898 ATGGAGGAGCAGTAAGTCCATGG - Intergenic
1131302853 15:91214833-91214855 ATTGAGGAGCAGAAAGAACGAGG - Intronic
1131908953 15:97174834-97174856 ATGAAACAGCAGAAAGACTAGGG - Intergenic
1135932172 16:26747565-26747587 AAAGAGTAGTAGAAAGAGCAGGG - Intergenic
1138243486 16:55447720-55447742 ATGGCCAAGCAGAAGGACCAAGG + Intronic
1139523129 16:67496758-67496780 ATCTAGTACCAGAAAGACCTTGG - Intergenic
1140424455 16:74849139-74849161 TTAGAGCAGCAGGAAGACCAAGG - Intergenic
1140644607 16:77015796-77015818 GGGGAGAAGGAGAAAGACCAAGG + Intergenic
1140861936 16:79025729-79025751 AAGGATTATCAGAAAGGCCATGG - Intronic
1141046201 16:80718161-80718183 CTGGTATAGCAGAAAGAGCACGG - Intronic
1141114433 16:81296312-81296334 ATGGAGAAGTGGAAAGACTAGGG - Intergenic
1141131617 16:81441454-81441476 ACGGAGTAGCAGGAAGGGCACGG - Intergenic
1142832315 17:2558360-2558382 AAGGAAGAGAAGAAAGACCAGGG + Intergenic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1143556015 17:7660961-7660983 ATGGAGTGGTAGACAAACCAAGG - Intergenic
1144225059 17:13137229-13137251 ATGATGTAGGAGAAAGAGCATGG - Intergenic
1144290904 17:13825312-13825334 ATGGAGTAAAAGCAAGACAAAGG - Intergenic
1145981936 17:29018007-29018029 ATGGGGTTTCAGAAAGAGCAGGG - Intronic
1146052452 17:29564779-29564801 GTGGTGTAGCAGAAAGACCTGGG - Intronic
1146496894 17:33330630-33330652 AAGGAGTATTAGAAAGAGCATGG - Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1149325067 17:55521774-55521796 ATGGAATAGCAGAAAATCCTGGG + Intergenic
1149371616 17:55999329-55999351 ATGGAATAGCAGAAAAACAAAGG - Intergenic
1149569395 17:57661773-57661795 ATGGAGTGGCAGAAAGAAAGGGG - Intronic
1150576252 17:66433474-66433496 ATGGAGTAGCTAAAGGAGCAGGG + Intronic
1151166978 17:72212298-72212320 ATAGAGTAGCAGAAACTACAAGG + Intergenic
1151787382 17:76281690-76281712 GTGGACCTGCAGAAAGACCAGGG + Intronic
1152969389 18:147226-147248 ATGGTGTAGCTGAAAGACATCGG + Intergenic
1153528159 18:6016915-6016937 ATGGAGAAGCAGCCAGGCCAGGG + Intronic
1153878882 18:9403530-9403552 AAGGAGTTGCAGAAGGATCAAGG + Intergenic
1156040147 18:32811269-32811291 ATGGAATTGCAGAAAGAGCAGGG - Intergenic
1157914703 18:51653924-51653946 ACGGAATAACAGAAAGACCATGG + Intergenic
1158163461 18:54512385-54512407 CTGCAATAGCAGAAAGACAATGG + Intergenic
1159057653 18:63482015-63482037 ATGGAGAAGGAGGAAGCCCATGG + Intronic
1159651875 18:70987391-70987413 ATGGAGTAACACAACCACCATGG + Intergenic
1160653648 19:247775-247797 AGGCAGTAGCAGGAAAACCAAGG - Intergenic
1163793114 19:19319987-19320009 CTGGGGAAGCAGAAAGGCCAAGG + Intronic
1165638607 19:37364791-37364813 AAGGAGGACCAGAGAGACCATGG + Intronic
1165740060 19:38199616-38199638 GGGGAGTAGCAGAAAGACCTGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166962179 19:46504152-46504174 AGAGAGGAGCAGAAAGACAACGG - Intronic
1167810351 19:51824341-51824363 GTGGAGGATCAGAAAGACCTTGG - Exonic
925055434 2:853571-853593 ATGGGGAAGCAGGCAGACCAAGG - Intergenic
925594463 2:5541594-5541616 ATGGAGTAGAAGAAATAAAAAGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
926639071 2:15215869-15215891 CTAGAGTAGTAGAAAGATCAGGG - Intronic
926750767 2:16196998-16197020 ATGGAAGTTCAGAAAGACCAAGG - Intergenic
927209347 2:20629301-20629323 ATGGAGGAGGAGGAGGACCAGGG - Intronic
927414397 2:22862794-22862816 ATGGACTAACAGTAAGGCCATGG + Intergenic
927807426 2:26160519-26160541 ATGGAGTAGAATAGAGACCTCGG - Intergenic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929822959 2:45288122-45288144 ATGGAGAAGCAGAGAAGCCAGGG - Intergenic
931940137 2:67242960-67242982 AAGGTCTAGGAGAAAGACCATGG - Intergenic
932084787 2:68748262-68748284 ATGGAGTGGAGGAAAGGCCATGG - Intronic
932193425 2:69761570-69761592 GTGGAGTAGCAGAAGCATCACGG - Intronic
932314515 2:70770725-70770747 ATGCAGTATCAGATAGACCCTGG - Intergenic
933290259 2:80430488-80430510 ATGGAACAGGAGAAAGAACATGG - Intronic
933755493 2:85634909-85634931 GTAGAGTTGCAGAAAAACCAGGG + Intronic
935097554 2:99960404-99960426 ATGAAGTATCAGAATGACTACGG - Intronic
935898953 2:107769966-107769988 AGGGAGTAGCAGAAATTTCAAGG - Intergenic
935951131 2:108329892-108329914 ATAGAGTAACAGAAAGAGCATGG - Intergenic
935986772 2:108680929-108680951 AAGGAATAGAAGAAAGAACAGGG - Intronic
936139210 2:109924582-109924604 AAGGAATAGAAGAAAGAACAGGG - Intergenic
936205486 2:110446904-110446926 AAGGAATAGAAGAAAGAACAGGG + Intronic
937720747 2:125092327-125092349 ATGGAGTACTAGAAAGATCTTGG - Intergenic
937743263 2:125380716-125380738 GTGGAGAACCAGAGAGACCAGGG + Intergenic
938292885 2:130159737-130159759 CTGGAGGAGGAGAAAGACCCTGG - Intronic
938863242 2:135391994-135392016 ATTAAGTAGCAGAAAAACAAGGG + Intronic
940074501 2:149726065-149726087 ATGGTGTAGCAGAAAAAGAAGGG + Intergenic
940982949 2:160023842-160023864 AGGGAGTAGCAGAAACAACACGG + Intronic
941722664 2:168828234-168828256 TTGGAGTTGGAGAAAGGCCAGGG - Intronic
942385652 2:175439770-175439792 AGGGAGTGACAGAAAGAACATGG + Intergenic
942404378 2:175637841-175637863 ATGGAGTGCCAGAAAGACTAGGG - Intergenic
942537467 2:176980073-176980095 GTGGAGAAGGAGAAAGACAATGG + Intergenic
943685085 2:190809959-190809981 AGGGGGTGGCAGAGAGACCAAGG - Intergenic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944469082 2:200033632-200033654 CTGGAGTCGGAGAAAGAACAGGG - Intergenic
944577886 2:201107160-201107182 GTGGCGTAGCAGAAAGAACATGG - Intergenic
945825539 2:214716662-214716684 AGGAAGCAGCAGAAAGACCCTGG + Intergenic
946060157 2:216934500-216934522 AGGGAGTGGCAGAGAGAACATGG - Intergenic
946526966 2:220531042-220531064 ATGGAATAGCAGAAAAAGTATGG + Intergenic
946783325 2:223215835-223215857 ATGCAGCAGCCAAAAGACCAGGG - Intergenic
947228787 2:227864926-227864948 ATACAGGTGCAGAAAGACCAGGG - Intergenic
947435596 2:230069335-230069357 ATGGACGTGCAGAAAGAGCAGGG - Intergenic
947629548 2:231643186-231643208 GTGGAATGGAAGAAAGACCAAGG + Intergenic
947759117 2:232590443-232590465 ATGGGGTACCAGTAAGACCAGGG - Intergenic
1169336301 20:4759984-4760006 AGGAAGTAGCAGAAAGGCCCTGG - Intergenic
1169718636 20:8647874-8647896 TTGGAGAAGCAGAAAAACAAGGG - Intronic
1169762232 20:9108382-9108404 ATGAAGTAGGAGGAAAACCAAGG + Intronic
1169859630 20:10137701-10137723 TTGAATTAGCAGAAAGACAAGGG + Intergenic
1170073748 20:12396926-12396948 ATGGTAGAGCAGAAAGACCAGGG - Intergenic
1170142381 20:13137899-13137921 CTTGAGTAGCAGAAAGCTCAGGG - Intronic
1171242460 20:23582537-23582559 AGGAAGCAGCAGAAAGACCCTGG - Intergenic
1171943060 20:31349536-31349558 ATAGAGCAGTAAAAAGACCAGGG + Intergenic
1173347600 20:42215221-42215243 TTGGTGTTGCAGAAATACCATGG + Intronic
1173578391 20:44128494-44128516 ATGGGGCAGGAGAAAGCCCATGG + Intronic
1174292888 20:49521479-49521501 TTTGAGTGGCAGAAAGTCCAGGG - Intronic
1175113358 20:56664556-56664578 ATGGAGGGCCAGAAAGACCTGGG + Intergenic
1175893499 20:62325634-62325656 ATGGAGGGGCACAAAGACCATGG + Intronic
1178775128 21:35542644-35542666 ATAGAGGGACAGAAAGACCAAGG + Intronic
1178959921 21:37056272-37056294 AGGGAGCAGCAGTGAGACCATGG + Intergenic
1181947431 22:26529084-26529106 AAGGGGTCTCAGAAAGACCAAGG + Intronic
1182804152 22:33056805-33056827 TTGGTGTAGTAGAAAGAACAAGG - Intronic
1185126115 22:49011771-49011793 CTTGAGTAGCAGGAAGACAATGG - Intergenic
950074484 3:10177611-10177633 ATGACTTAGGAGAAAGACCACGG - Intronic
950126474 3:10512953-10512975 ATGGAGAAGCAGGAAGCACATGG - Intronic
952410597 3:33046693-33046715 ATGGATCAGCAGAAAACCCAGGG + Intronic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
953631464 3:44621566-44621588 ATGTGGCAGCAGAAGGACCAAGG - Intronic
953679636 3:45029743-45029765 CTGGTGTTTCAGAAAGACCAGGG + Intronic
955175745 3:56611744-56611766 AGGAAGTAGCAGAAAGACACTGG - Intronic
955555696 3:60134939-60134961 ATGGAGTAGAGGAAAGAGAAAGG + Intronic
955931976 3:64066495-64066517 GTAGAGTGGCAGAAAGAGCAGGG + Intergenic
955980071 3:64515885-64515907 TTGGAGGGGCAGAAAGACCATGG + Exonic
957528397 3:81407702-81407724 ATGGAGTTGGAGAAGGACTACGG - Intergenic
957840717 3:85665659-85665681 GTGGACTACCAGAAAGACAAAGG - Intronic
957949735 3:87109011-87109033 ATAGAGTAGCAAAAAGGGCATGG + Intergenic
959646946 3:108713928-108713950 GTCGTGTAGCAGAAAGAGCATGG - Intergenic
961834159 3:129642730-129642752 ATGGAATAGCAGAAATTGCATGG + Intergenic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
962744116 3:138384800-138384822 CTGTAGTAGGATAAAGACCAAGG + Intronic
962920527 3:139946453-139946475 GTGGAGTAGCAGCAAGACCAAGG - Intronic
963264174 3:143222763-143222785 ATGGAGTAGCTGCAAGACAGAGG + Intergenic
965639450 3:170817219-170817241 ATGATGTGGCAGAAAGAGCATGG + Intronic
966236019 3:177702435-177702457 TTTGAGAAGCAGAAACACCAAGG + Intergenic
966256235 3:177918878-177918900 ATGGAGTTTGAGAAAGACTAGGG + Intergenic
967877255 3:194275804-194275826 AGGGGGAAGCGGAAAGACCATGG - Intergenic
967919033 3:194600787-194600809 ATAGATTACCAGAAGGACCAGGG + Intronic
968552296 4:1229870-1229892 ATGGAGGACCACACAGACCAGGG + Intronic
968956575 4:3722572-3722594 CTGGAGTTGCAGCAAGACCAGGG - Intergenic
970527837 4:16950217-16950239 ATAGAGTAGTAAAAACACCATGG + Intergenic
970736330 4:19173331-19173353 ATGGAGTAGTACATATACCAAGG + Intergenic
973158348 4:46986475-46986497 GTGAAGTAGCAGGAAAACCAAGG - Intronic
973718913 4:53703899-53703921 TTTGAATAGAAGAAAGACCATGG - Intronic
975435944 4:74351227-74351249 ATGGAACACCAGAAAGGCCAGGG + Intergenic
976084745 4:81395849-81395871 ATGGGGTAGCAGAGTGGCCAAGG - Intergenic
976792765 4:88897660-88897682 ATGGAGTACCATTAATACCAAGG + Intronic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
979624662 4:122831005-122831027 ATGCAGTAGCAAAGAGCCCAGGG - Intronic
981656428 4:147117069-147117091 CTGGTGTAGCAGAAGGATCATGG - Intergenic
982016235 4:151156434-151156456 ATGTAGTAGCAAAAACAGCATGG + Intronic
983870734 4:172822449-172822471 CTGGAGTTCCAGAGAGACCATGG - Intronic
986309706 5:6543145-6543167 ATGGAGCAGCCCAAGGACCAAGG - Intergenic
986818215 5:11436006-11436028 CTGGAATAGGAGAAAGACGACGG + Intronic
987220221 5:15783582-15783604 AAGGAGTAGCAAGAAAACCAAGG + Intronic
988983722 5:36596869-36596891 ATGGAAGAGAAGAAAAACCAGGG + Intergenic
989758309 5:44983151-44983173 CAGGAGGATCAGAAAGACCATGG + Intergenic
993182511 5:84572676-84572698 ATTGATCACCAGAAAGACCAAGG + Intergenic
993964208 5:94340915-94340937 ATTCAGTAGGAGAAAGAACATGG + Intronic
995755799 5:115502782-115502804 CAGGAATAGCAGAAAGGCCATGG - Intergenic
996010655 5:118478671-118478693 AGGAAGCAGCAGAAAGACCCTGG + Intergenic
998838588 5:146228911-146228933 ATTGAGTAGAAGTAAGAGCAGGG - Intronic
999275683 5:150328552-150328574 GTGGGCCAGCAGAAAGACCATGG + Intronic
1000030807 5:157399536-157399558 ATGGTGGAGTAGAAAGGCCAAGG + Intronic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1001469517 5:172000867-172000889 ATGGTTTAGCAGAAAGGGCATGG - Intronic
1001889397 5:175326710-175326732 ATGGAGCAGTGGAAAGTCCATGG + Intergenic
1002088503 5:176790968-176790990 ATGGACTAGCAGGAAGAGCCTGG - Intergenic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1003712020 6:8602867-8602889 AGGAAGCAGCAGAAAGACCCTGG - Intergenic
1003803544 6:9699785-9699807 ATGGAGTAGCAGAAAGACCACGG - Intronic
1004563245 6:16771330-16771352 AAGGAGAATCAGAAAGACCAAGG - Intergenic
1004827602 6:19440390-19440412 ATGGTGTAGTGGAAAGAACATGG - Intergenic
1005492636 6:26360742-26360764 ATAGAGTTGCAGAAAGGTCAAGG - Intergenic
1006002196 6:30973910-30973932 ATAGTGTAGTATAAAGACCAGGG + Intergenic
1007075498 6:39063657-39063679 AAGGAGGAGAAGAAAGAGCAGGG + Intronic
1007907647 6:45478593-45478615 ATGGAATAGTTAAAAGACCAAGG - Intronic
1010676719 6:78753969-78753991 ATGGAAGAGCAGGAAGAACATGG + Intergenic
1012389491 6:98721257-98721279 ATTTATTACCAGAAAGACCAGGG + Intergenic
1013852732 6:114535096-114535118 AGGAAGCAGCAGAAAGACCCGGG - Intergenic
1014117631 6:117684100-117684122 AGTGAGTAACAGAAAGACAAAGG - Intronic
1014299829 6:119667461-119667483 AAGGAGTAGCTGAGAGACCAAGG - Intergenic
1015509302 6:134022153-134022175 ATATAGAAGCAGAAAGAACATGG + Intronic
1016012403 6:139151478-139151500 ATTAAGTAGCAGAAAAAGCACGG - Intronic
1016294607 6:142561471-142561493 ATTGGGGAGCAGGAAGACCATGG + Intergenic
1016667555 6:146659685-146659707 ATTGAGTAGCATTAAGAACAGGG + Intronic
1017530656 6:155289017-155289039 ATGGAGTATGAGAAAAACAAGGG + Intronic
1017592803 6:155994927-155994949 AAGGAGTATCAGAAAAACCAAGG + Intergenic
1019362273 7:611029-611051 ATGGAGCAAGAGACAGACCAGGG - Intronic
1019513759 7:1430748-1430770 ATGGCGTGGCAGAAAGACGGAGG + Intronic
1020405890 7:7833780-7833802 ATGGAATAGCAGCCAGAACATGG + Intronic
1020433046 7:8132821-8132843 ATGGAGTTCCAGAAAGAACTTGG - Intronic
1021781506 7:24111281-24111303 ATGGAGAGGTAGAAAGACCATGG + Intergenic
1023664502 7:42508498-42508520 AGGAGATAGCAGAAAGACCAAGG - Intergenic
1023720231 7:43085359-43085381 ATGGATTAGCAGAAAAATCCTGG + Intergenic
1026646541 7:72175665-72175687 ATGGAGAAGTAGGCAGACCAGGG + Intronic
1026861429 7:73792661-73792683 ATGGCATACCAGAAAGAGCAGGG - Intergenic
1027953063 7:84843821-84843843 AGGGAGAAGCAGAAACAACATGG - Intergenic
1029476010 7:100785052-100785074 ATGGTATAGTGGAAAGACCATGG + Intronic
1030272447 7:107685110-107685132 ATGGAGTAGCTTAAAGTCCCTGG - Intronic
1030864527 7:114683362-114683384 ATGGGGTAGCAGAAATAACAAGG + Intronic
1030935891 7:115584876-115584898 AGGAAGTAGCAGAAAGGCCCTGG + Intergenic
1031609067 7:123803789-123803811 ATGCAGAAGAAGAAAGACAAAGG - Intergenic
1031761345 7:125716478-125716500 AGGAAGCAGCAGAAAGACCCTGG - Intergenic
1031971729 7:128069489-128069511 ATGAGGTGGCAGAAAGAGCATGG - Intronic
1032456366 7:132076153-132076175 GTGGAGGGGCAGAAAGAGCATGG - Intergenic
1033000824 7:137502516-137502538 ATGGAGGAGGAGGAAGAACAAGG + Intronic
1033362174 7:140645421-140645443 ATGGGGTAACAAAAAGAACATGG + Intronic
1033465536 7:141585962-141585984 ATGGTGTAGTGGAAAGAACATGG + Intronic
1033564372 7:142564283-142564305 AAGGAGAAGGAGAAACACCAGGG - Intergenic
1033648678 7:143323648-143323670 ATGGACTAGCAGGGAGAGCATGG - Intronic
1033789786 7:144777752-144777774 AAGCAGTAGAAGAAAGGCCAAGG + Intronic
1035513177 8:207570-207592 AGGCAGTAGCAGGAAAACCAAGG - Intergenic
1039202266 8:35108932-35108954 AGGGAGTATCAGGAATACCAGGG + Intergenic
1039641401 8:39227340-39227362 ATGAAGCAGGAGAAAGACCGTGG + Intronic
1040847328 8:51857492-51857514 ATGGAGTATCAGAACCACGAAGG - Intronic
1041070463 8:54123392-54123414 GTGAAATAGCAGAAAGACCTGGG + Intergenic
1041098988 8:54377969-54377991 ATGGAGAAGCAGATATGCCAGGG - Intergenic
1041878080 8:62712892-62712914 AGGGAGCAGCAGAAAGGCCCTGG - Intronic
1042009907 8:64231550-64231572 ATGGGATAGCAGAAAGATCATGG - Intergenic
1042335175 8:67622442-67622464 ATGCAATACCAGAGAGACCATGG - Intronic
1044386534 8:91595476-91595498 ATGGAGCAGGAGACAGACCCAGG + Intergenic
1044465121 8:92493537-92493559 CTGGAGGAGAAGAAAGACAATGG + Intergenic
1045106061 8:98893790-98893812 ATGGAGAAGCTGCAAGAACAAGG + Intronic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1045481690 8:102597868-102597890 ATGGAGTGCCAGCAAGAGCAGGG + Intergenic
1046337038 8:112804090-112804112 ATGGTGTATCCGAAAGACAAGGG + Intronic
1049605094 8:143525671-143525693 AAGGCATAGCAGGAAGACCAGGG - Intronic
1050805305 9:9670184-9670206 ATGTAGAAGCAACAAGACCAGGG + Intronic
1052020925 9:23524495-23524517 AAGTAGGAGGAGAAAGACCAGGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052944138 9:34153878-34153900 ATGGTGTAACAGAAAAAGCATGG + Intergenic
1054896850 9:70323076-70323098 ATGGTGTAGTGGAAAGAACATGG + Intronic
1055468942 9:76592442-76592464 AGGGAGTAGCACAGAGGCCATGG - Intergenic
1055798863 9:80009097-80009119 CTGCAGTAGCAGAAACACGATGG + Intergenic
1055880245 9:80992565-80992587 ATGGATTAGAATAAAGAACATGG - Intergenic
1056105689 9:83344107-83344129 GTGGAGTAACAGAAAGGACAGGG - Intronic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056551243 9:87654637-87654659 ATGAAGTAGCATCAAGACCTTGG + Intronic
1056869611 9:90265038-90265060 GAGGAATAGCAAAAAGACCAAGG - Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057550122 9:96046314-96046336 ATGGAGCTGGTGAAAGACCAAGG + Intergenic
1058241287 9:102564442-102564464 TTGTAGTAGCAGAAAGACCCTGG + Intergenic
1058874352 9:109230204-109230226 AAAGAGGAGCAGAAAGACCAAGG + Intronic
1059585408 9:115600851-115600873 AAGGAGAGGAAGAAAGACCAAGG + Intergenic
1060188185 9:121576528-121576550 GTGGGATAGCAGAAAGCCCAGGG - Intronic
1060852433 9:126888878-126888900 ATGGAGTAGAACAGAGAGCAGGG - Intergenic
1060865029 9:126988824-126988846 AGGGAGCAGCAGGAAGAACAAGG + Intronic
1061337841 9:129953724-129953746 ATGGAGAAGAAGAAAGACTGAGG + Intronic
1187250536 X:17594209-17594231 ATGGTGTACCAGAAAGAGCATGG - Intronic
1187309273 X:18125533-18125555 AAGGAGTATCAGAAAAACCATGG + Intergenic
1187977197 X:24714899-24714921 AGTGAGTAGCAGGAAGATCATGG + Intronic
1189328817 X:40130352-40130374 TTGGAGGACCAGGAAGACCAGGG - Intronic
1190337986 X:49274407-49274429 TTGGAGTAACAGAAAGACCATGG - Intronic
1190407865 X:50105465-50105487 CTGGTGTAGTAGAAAGAGCATGG + Intergenic
1192054164 X:67756455-67756477 GTAGAGGAGGAGAAAGACCAGGG - Intergenic
1194605598 X:95974766-95974788 AGGGAGCAGCAGAAAGGCCCTGG + Intergenic
1195275406 X:103276186-103276208 ATGGAGGAGGAGGAGGACCAGGG - Intronic
1195403065 X:104482532-104482554 ATGGAGTAGTCGAAAGATCAGGG - Intergenic
1196070019 X:111510124-111510146 ATGGTATAGCAGAAAGATCAGGG - Intergenic
1197117221 X:122848018-122848040 ATGGTGCAACAGAAAGAGCACGG - Intergenic
1197671755 X:129284890-129284912 AGGGAGCAGCAGAAAGGCCCTGG - Intergenic
1197693384 X:129525448-129525470 AAGTAGTAGCAGATAGAGCAAGG - Intergenic
1198029488 X:132741262-132741284 ATGGTGTAGAAGAAACAGCACGG + Intronic
1198438975 X:136643475-136643497 GTGGAGAGGCAGGAAGACCAGGG - Intergenic
1198607935 X:138364375-138364397 ATTGAGTGACAGAAAGACAAAGG - Intergenic
1198843140 X:140880538-140880560 AGGAAGTAGCAGAAAGGCCCTGG + Intergenic
1199350972 X:146799271-146799293 ATGTAGAATAAGAAAGACCAAGG - Intergenic
1200414971 Y:2900013-2900035 AGGAAGCAGCAGAAAGTCCATGG + Intronic
1201200547 Y:11536104-11536126 ATGGAGTAGAATAAATACTATGG + Intergenic
1201201171 Y:11541695-11541717 ATGGAGTAGAATAAATACTATGG + Intergenic
1201201561 Y:11545056-11545078 ATGGAGTAGAATAAATACTATGG + Intergenic
1201201952 Y:11548421-11548443 ATGGAGTAGAATAAATACTATGG + Intergenic
1201202599 Y:11554051-11554073 ATGGAGTAGAATAAATACTATGG + Intergenic
1201203252 Y:11559692-11559714 ATGGAGTAGAATAAATACTATGG + Intergenic
1201203909 Y:11565299-11565321 ATGGAGTAGAATAAATACTATGG + Intergenic
1201204554 Y:11570896-11570918 ATGGAGTAGAATAAATACTATGG + Intergenic
1201205206 Y:11576508-11576530 ATGGAGTAGAATAAATACTATGG + Intergenic
1201205855 Y:11582114-11582136 ATGGAGTAGAATAAATACTATGG + Intergenic
1201206503 Y:11587721-11587743 ATGGAGTAGAATAAATACTATGG + Intergenic