ID: 1003809478

View in Genome Browser
Species Human (GRCh38)
Location 6:9763971-9763993
Sequence AAACCAGGGGTTGAGGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003809478_1003809484 -2 Left 1003809478 6:9763971-9763993 CCCATATCCTCAACCCCTGGTTT 0: 1
1: 0
2: 0
3: 21
4: 185
Right 1003809484 6:9763992-9764014 TTAAAAAGAAATGTGTATAGTGG No data
1003809478_1003809487 30 Left 1003809478 6:9763971-9763993 CCCATATCCTCAACCCCTGGTTT 0: 1
1: 0
2: 0
3: 21
4: 185
Right 1003809487 6:9764024-9764046 CCATATTACCCTTTTTTTAATGG 0: 1
1: 0
2: 3
3: 81
4: 1059

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003809478 Original CRISPR AAACCAGGGGTTGAGGATAT GGG (reversed) Intronic
901950323 1:12740223-12740245 ATACCAGGGGTTTAGGAGAAGGG + Intergenic
905585029 1:39110124-39110146 AAAATATGGGTTGAGGATTTGGG + Intronic
906319917 1:44809415-44809437 AAACCAGGGGTAGAGTTTACAGG + Intronic
906396422 1:45470127-45470149 AAACAATGTGATGAGGATATTGG - Intronic
906508120 1:46394861-46394883 ATGCCAGGGGTTGAGGACTTTGG + Intronic
906807717 1:48795398-48795420 AAAGAAGGGGTTGAGGAAAAGGG - Intronic
907963248 1:59303265-59303287 TTACCAGGGATTGAGGAAATGGG - Intronic
908075164 1:60509337-60509359 AAACCAAGGGTTGGTGAGATGGG - Intergenic
908663784 1:66466590-66466612 ATACCAGGGGTTCAGCATTTAGG - Intergenic
910141700 1:84033341-84033363 AAACCAGCTGTTGAGGATGTTGG - Intergenic
911394868 1:97292798-97292820 AAACAAGGGTTTGGGGATCTGGG + Intronic
911838818 1:102655940-102655962 AGAGAAGGGGATGAGGATATGGG + Intergenic
911930829 1:103901345-103901367 AAAGAAGGAGTTGAGGAGATTGG + Intergenic
912073762 1:105846796-105846818 ATAGAAGAGGTTGAGGATATAGG - Intergenic
912885658 1:113470688-113470710 AGATCAGGGGATGAGGAAATGGG - Intronic
913292983 1:117292514-117292536 AAGCCAGGGGTAGAGGTTTTAGG + Intergenic
914423626 1:147553493-147553515 AAACCAGAGGGTAAGGATTTAGG + Intronic
917540764 1:175911796-175911818 AAACCAAGGGATCAGGATATAGG + Intergenic
917858829 1:179124996-179125018 TAGCCAGGGGATGAGGATGTGGG - Intronic
919740844 1:200980840-200980862 CCCCCAGGAGTTGAGGATATGGG - Intronic
920200254 1:204255830-204255852 AAGGGAGGGGTTGAGGATGTGGG + Intronic
923157508 1:231291544-231291566 AAATTAAGGGTTGAGAATATAGG + Intergenic
1064359387 10:14649972-14649994 AAACCATGTGTTAAGGATACTGG - Intronic
1064839902 10:19579867-19579889 AAGTCAGGAGTTGAGGATTTGGG + Intronic
1064883395 10:20082349-20082371 AAATCAGGTGTGGAGTATATGGG + Intronic
1067434841 10:46269674-46269696 AAAACAGGTGGTGAGGATGTGGG - Intergenic
1068533243 10:58211833-58211855 AACCCAGGGGTTGAGGCTGCAGG + Intronic
1069194412 10:65531225-65531247 AAGCCAGGGGTGGAGGGTGTGGG + Intergenic
1070233684 10:74600125-74600147 AAGCAAGTGGATGAGGATATAGG + Intronic
1072622342 10:97088361-97088383 TAACTAGGTGTTGAGGATATTGG + Intronic
1074569049 10:114607992-114608014 AAACCAAGTGTTGAGTATACAGG + Intronic
1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG + Intronic
1078483660 11:11702396-11702418 TTACCAGGGGATGAGGGTATGGG + Intergenic
1080874274 11:36262148-36262170 AAACCAGGGGCTGAGCACAGTGG + Intergenic
1081712119 11:45224184-45224206 AAACCAGGGTGTAAGGAAATGGG - Intronic
1083495393 11:63047646-63047668 AAAGCAGGCTTTGAGGATCTTGG - Intergenic
1083737768 11:64691409-64691431 AAGCCAGGTGCTGAGTATATAGG - Intronic
1084018061 11:66398537-66398559 TTGCCAGGGGTTGAGGATGTGGG - Intergenic
1085706842 11:78794192-78794214 AAAGGAGGGGTTGAAGATACTGG + Intronic
1086429192 11:86718894-86718916 ACACCAGGGATTTAGGATTTGGG - Intergenic
1088395806 11:109367494-109367516 AAACCAGGAATTCAGGATAATGG + Intergenic
1090044326 11:123317449-123317471 GGGCTAGGGGTTGAGGATATGGG + Intergenic
1090576187 11:128106363-128106385 AAGCGAGGGGCTGAGGATGTGGG - Intergenic
1093769485 12:23002492-23002514 GAACCAGGGGCTGGGGATAGTGG + Intergenic
1094536664 12:31327245-31327267 AAACCCGGGGTTAATGATAGAGG + Intergenic
1094873944 12:34619819-34619841 AGACAGGGGGTTGAGGGTATAGG + Intergenic
1096265790 12:50121502-50121524 AGTACAGGGGTTGAGGATATAGG - Intergenic
1096428393 12:51523183-51523205 GAACCAGTAGTTGAAGATATAGG - Intergenic
1097168038 12:57096105-57096127 AGGCCAGGGATAGAGGATATTGG - Exonic
1099177690 12:79440847-79440869 CAACCAGTAGCTGAGGATATAGG + Intronic
1101470202 12:104988927-104988949 AAACCAGTTTTTGTGGATATAGG + Intronic
1102362794 12:112302854-112302876 AAGCCAGGGGTTCAGCACATAGG - Intronic
1103704877 12:122866013-122866035 CACCCAGGGGCAGAGGATATTGG + Exonic
1104041358 12:125133448-125133470 AACCCAGGGGATGAGGAGACGGG - Intronic
1106103646 13:26715498-26715520 TTACCCGGGGTTGAGGAGATGGG - Intergenic
1108074499 13:46665788-46665810 AGACCAGGGGTGTAGGATAGTGG + Intronic
1112523528 13:100120626-100120648 AATCCAGGGGATGAGGCTATAGG + Intronic
1112803332 13:103136022-103136044 AAACGAGGCTGTGAGGATATAGG + Intergenic
1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG + Exonic
1118254955 14:64197419-64197441 AAATCAGGGCTTCAGGATCTTGG + Intronic
1120160472 14:81139959-81139981 AAACCAGGTGGAGAGGAAATTGG + Intronic
1124133430 15:27010693-27010715 CAACCAGGAGTTTGGGATATGGG - Intronic
1125586465 15:40824026-40824048 CAACCTGGTGTTGAGAATATGGG + Intronic
1125995232 15:44153527-44153549 TTACCAGGGGTTGAGGGGATAGG + Intronic
1127103747 15:55591550-55591572 TTACCAGGGGTTGAGGATAAAGG + Intergenic
1127435890 15:58957812-58957834 ATACCAGGAGGTGAGGATATTGG + Intronic
1128407929 15:67362754-67362776 AACCCAAGTGTTGTGGATATAGG - Intronic
1128682507 15:69662097-69662119 AAAACAGAGGCTGAGGGTATGGG + Intergenic
1128989821 15:72250327-72250349 GAACCAGCAGTTGAGGATTTAGG - Intronic
1129077072 15:73006074-73006096 AAACCAGGGATAGAAGATACGGG - Intergenic
1129368126 15:75069500-75069522 AAACCAGGGATTGGGAATAGTGG + Intronic
1129747247 15:78031821-78031843 AAACCATGGTTTTTGGATATTGG + Intronic
1135250772 16:20899947-20899969 AACCCAGGGCCTGGGGATATGGG - Intronic
1135536833 16:23301539-23301561 AAACTAAGTGTTAAGGATATTGG + Intronic
1135658064 16:24268895-24268917 AAACCTGGAGTTGAGGATGAGGG - Intronic
1135932686 16:26751947-26751969 AAGTCAGGGGATGAGGTTATGGG - Intergenic
1136490633 16:30605523-30605545 AGACCAGGGGGTGAGTCTATTGG - Intronic
1137762871 16:50954788-50954810 ATACCCGGGGCTGAGGCTATTGG - Intergenic
1143901866 17:10180545-10180567 AAAACAGGCGTTGAAGAAATCGG - Intronic
1144464865 17:15489046-15489068 AAACCTAGGGGTGAGGATCTTGG + Intronic
1147740916 17:42670515-42670537 AAACCAGGGGTTCAGGCTTGGGG + Intronic
1149576926 17:57720636-57720658 AAGCCAGATGTGGAGGATATGGG + Intergenic
1151441912 17:74135123-74135145 AAACCAGGGGTACAGGAGAAGGG - Intergenic
1151480786 17:74369129-74369151 AAACCTGGGGCTGAGGACTTTGG - Intronic
1153184146 18:2468450-2468472 AATCCAGTGGGTGAGGAAATGGG - Intergenic
1154953595 18:21233472-21233494 AACCCAGGGGTTCATGACATTGG - Intergenic
1155158555 18:23177802-23177824 AAACCAGGTGTGGAGTACATGGG - Intronic
1157106537 18:44779385-44779407 AAACCAGGAGTAGAGGTTTTAGG + Intronic
1159744202 18:72211027-72211049 GAAGCAGGGGTTGAGGACAGAGG + Intergenic
1161025050 19:2032916-2032938 AAACCAGGTGCAGAGGATGTTGG + Intronic
1162420373 19:10562694-10562716 GAACCAGGGGGTGGGGATGTAGG + Intronic
1163845558 19:19636565-19636587 AAAAAAGAGGTTGAGGAAATAGG + Intronic
1166927287 19:46277728-46277750 AAACAAGGGGTTTAGGTTTTAGG + Intergenic
1167099273 19:47394018-47394040 AAACAAGGGGTTTAGGTTTTAGG - Intergenic
1167326990 19:48832723-48832745 AAACCAGGGTCTGAGGAGAAAGG + Exonic
928713533 2:34034352-34034374 AAACCAGGGGATGGGGAAGTTGG - Intergenic
929788373 2:45007626-45007648 ACACCTGGGGTTGGTGATATGGG - Intronic
929972288 2:46592850-46592872 GAACCAGGAGTTGATGATAGGGG - Intronic
931337765 2:61365635-61365657 AAAACAGGAGTTGAGGAAAAAGG + Intronic
931652121 2:64477975-64477997 AAAACAGGAGTAGAGGATATGGG - Intergenic
931809692 2:65842713-65842735 ACAGCAGAGGTTGTGGATATGGG + Intergenic
933251663 2:80036055-80036077 AAATCAGGGTTTGAGGAACTGGG + Intronic
933818362 2:86087348-86087370 TCACCAGGGTTTGAGAATATGGG - Intronic
934156264 2:89203756-89203778 AGATCAGTGGTTGAGGAGATTGG + Intergenic
934211050 2:89979007-89979029 AGATCAGTGGTTGAGGAGATTGG - Intergenic
935282267 2:101528451-101528473 AAACCACGTGTTGAGCAGATAGG - Intergenic
938591633 2:132742982-132743004 AGACCAGGGGATATGGATATGGG + Intronic
939853643 2:147330750-147330772 AAACCAGTGAATGATGATATAGG - Intergenic
941695951 2:168550942-168550964 AAGCCAGGGGATGAGGAACTGGG + Intronic
942318162 2:174713179-174713201 GAACCAGGGGTTGGGGGTAGGGG + Intergenic
942328460 2:174796033-174796055 AAACCAGGGGAGGAGGTTATAGG - Intergenic
942907104 2:181196668-181196690 AAACCAGAAGAGGAGGATATGGG - Intergenic
944481804 2:200164733-200164755 AAAACAGGAGATGGGGATATTGG + Intergenic
946794427 2:223334755-223334777 AAATCTGGGGCTGAGGCTATGGG - Intergenic
948084763 2:235238212-235238234 AAATCAGGAGTTGAGCATCTGGG + Intergenic
948313936 2:237012440-237012462 AAACCAGGATGTGAGGAAATGGG - Intergenic
1170437927 20:16349634-16349656 AAACTGGTGGTGGAGGATATGGG - Intronic
1171509464 20:25669487-25669509 GAATCAGGGGATGAGGATTTTGG - Intergenic
1172321361 20:33997483-33997505 AGTCCAGGGTTTGGGGATATTGG + Intronic
1173901702 20:46595254-46595276 AAACCAGAGGTTTAGAATAATGG + Intronic
1175837625 20:62006330-62006352 AAACCAGAGGTTGAGGCCCTGGG - Intronic
1180733474 22:17999466-17999488 AGACCTGGGGATGATGATATTGG - Intronic
949175660 3:1059483-1059505 AAACCACTGCTTGAGGAAATAGG - Intergenic
949936756 3:9121708-9121730 AAGGCAGGGATTGTGGATATGGG - Intronic
956046949 3:65205846-65205868 AAAGCAGGGATTGAGGATAGTGG + Intergenic
956389170 3:68753241-68753263 ACCCCAGGGGTTGAGGATCCTGG - Intronic
957902284 3:86510198-86510220 ATACCAGGGGCTGAGGAGAGGGG + Intergenic
958584204 3:96065140-96065162 AAAAGAGGGGTGGTGGATATTGG + Intergenic
958916350 3:100054734-100054756 ATCCCAGGGCTTGAGGGTATTGG - Intronic
959222898 3:103544151-103544173 AAACCACTGCTTGAGGAAATGGG - Intergenic
959379847 3:105628806-105628828 AAACCAGGGGCTTAGGGCATAGG - Intergenic
959769744 3:110078788-110078810 GAAGGAGGGCTTGAGGATATTGG - Intergenic
960900944 3:122553871-122553893 AGACCAGGCCTTGAGGCTATAGG + Intronic
962535185 3:136322631-136322653 AAACCAGGATTTGAGTATTTTGG - Intronic
965473615 3:169126772-169126794 TAACCAGGAGAAGAGGATATAGG + Intronic
966801760 3:183770529-183770551 AAATTTGGGGTGGAGGATATGGG - Intronic
967068309 3:185939837-185939859 AAATCAGGAGTTGGGGATATGGG - Intergenic
968039150 3:195573842-195573864 AAACCAGGAGTTGAGGTGAGTGG - Exonic
973805651 4:54523598-54523620 AAGCCAGGTGATGGGGATATGGG + Intergenic
973951080 4:56015062-56015084 AAACCAGGACTTGATGATTTTGG + Intronic
974951575 4:68589336-68589358 AAAGCAAGGTTTTAGGATATAGG - Intronic
976972685 4:91126867-91126889 AAACCTGGGATTGAAGATACAGG + Intronic
977221822 4:94346383-94346405 AAACCTGGGGTTGAAAATACAGG + Intergenic
978154153 4:105471196-105471218 AAACCATGGAATGAGGAGATTGG - Intronic
978769975 4:112445381-112445403 CAACCAGGTGTTGGGTATATGGG - Intergenic
982731746 4:158963612-158963634 ATACCAGGGGGTGAGAATCTTGG - Intronic
983045721 4:162984557-162984579 GCACCAAGGGTTGAGGTTATGGG - Intergenic
983571879 4:169217596-169217618 AAACCAGGGGTTCTGGACAAAGG + Intronic
983704072 4:170636190-170636212 AAACCAGGGGTGGAGGTGACTGG + Intergenic
985858574 5:2450635-2450657 AAAGCAGGGGTGGAGGAGCTGGG + Intergenic
986021442 5:3807826-3807848 GAACCAGGGGTTGGGGGTAGTGG - Intergenic
988374477 5:30416402-30416424 AAAGCAGGTGTGGAGTATATGGG + Intergenic
992935845 5:81704010-81704032 ACACCAGGAGCTGAGGAAATTGG + Intronic
995128890 5:108609140-108609162 AACCCGGGGGTGGAGGTTATAGG - Intergenic
995227752 5:109722123-109722145 AAACCACAGGCTGAGCATATAGG + Intronic
997511842 5:134459638-134459660 AGGCCTGGGGTTGAGGATACTGG - Intergenic
998370755 5:141659586-141659608 AACCAAGGGGGTGAGGATGTTGG + Intronic
999766249 5:154743202-154743224 GAACCAGGGGCTGTGGATAGCGG - Intronic
1000635123 5:163635247-163635269 AAACTTGGGGTTAAGGAAATGGG + Intergenic
1001397772 5:171429111-171429133 AAGCCCGGGGTTGAGGAGGTGGG + Intronic
1002451409 5:179320950-179320972 AAGCCAAGGGTTGGGGATGTGGG + Intronic
1003809478 6:9763971-9763993 AAACCAGGGGTTGAGGATATGGG - Intronic
1003839064 6:10101576-10101598 AAAGCAGGGGGAGAGGAGATAGG - Intronic
1006326116 6:33355394-33355416 CAAACAGGGGGTGAGGATGTGGG - Intergenic
1007500923 6:42296180-42296202 AAACCAGGGGTTCTGAAAATGGG - Intronic
1011036485 6:82982187-82982209 GATCCAGGGGTTGAGAGTATTGG - Intronic
1013158169 6:107514060-107514082 AATCCAGTGGTTAAGGATATAGG - Intronic
1013617560 6:111858976-111858998 AGAACAGAGATTGAGGATATTGG - Intronic
1019255926 7:50864-50886 AAACATGGGGTTGCAGATATTGG - Intergenic
1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG + Intronic
1021607234 7:22420350-22420372 ACACCATGGATTGAGGATATGGG - Intronic
1021852764 7:24824767-24824789 AAAGCAGGGCATGAGGATGTGGG + Intronic
1023967198 7:44969213-44969235 GAAACAGGGTTTGAGGATAGTGG - Intronic
1024571453 7:50726012-50726034 AAACCAGGGCTTGCAGATATTGG - Intronic
1024872923 7:53986823-53986845 AAACCACTGGTTGAGCATATTGG - Intergenic
1029795168 7:102886855-102886877 AAACCAGGGGCTGAGCATGCAGG + Intronic
1032189741 7:129757765-129757787 AAACCAGGGAGTGAGGATGCAGG - Intergenic
1032297108 7:130649326-130649348 GAACCAGGGCTTGATGATTTTGG - Intronic
1033085655 7:138339342-138339364 CAAACAGGTGGTGAGGATATGGG - Intergenic
1033155671 7:138954893-138954915 GACCCAGGGGCTGAGGATAAGGG + Intronic
1037021069 8:13971275-13971297 AAATCAGTGGTTGATGATATTGG + Intergenic
1038410708 8:27356881-27356903 AAACTAGGGGTTGTGGAGATGGG + Intronic
1040616075 8:49039946-49039968 AAGCCAGGGGTTGGGGGAATGGG + Intergenic
1041492502 8:58450203-58450225 AAACCAGGACTTGATGATTTGGG - Exonic
1041730851 8:61061292-61061314 AAACCAGGGGTAAAGGAAAGAGG + Intronic
1041945316 8:63434250-63434272 AAACCAGTGTTTGAGTGTATGGG - Intergenic
1042866406 8:73360180-73360202 AAACAAGGTGATGAGGCTATGGG - Intergenic
1045345320 8:101288731-101288753 AAACCAGGGGATGGAGATGTAGG - Intergenic
1045867657 8:106886738-106886760 AAAAGAGGGGGTGAGGTTATGGG + Intergenic
1055574238 9:77646476-77646498 AACCCAGGGGATAAGGATAAGGG + Intronic
1059373525 9:113863113-113863135 ATACCAGGAGATGAGGATAAGGG + Intergenic
1059631318 9:116125971-116125993 AAACCATGGGTTGAAAATATTGG + Intergenic
1060042587 9:120312130-120312152 GAACCAGGGGCTGAGAATCTTGG - Intergenic
1186414748 X:9373433-9373455 AACCCTGGGGTTGAGGTTATGGG + Intergenic
1186615047 X:11177515-11177537 AAACCAGGTGTGGAGGAAACTGG - Intronic
1186680474 X:11868352-11868374 GACCCAGGGGTTGAGGATGGAGG + Intergenic
1186831499 X:13394873-13394895 AAAGAAGTGGTTGAGGGTATGGG + Intergenic
1188388158 X:29587355-29587377 TTACCAGGGGTTGAGGTTGTGGG + Intronic
1192163754 X:68809803-68809825 GAGAAAGGGGTTGAGGATATGGG - Intergenic
1192555254 X:72084151-72084173 CAACCAAGGGTGGAGGATATAGG - Intergenic
1192581219 X:72283497-72283519 TTACCAGGGGTTAAGGGTATGGG - Intronic
1193756186 X:85411394-85411416 AGTCCGGGGGTTGAGGAAATAGG - Intergenic
1195284687 X:103372526-103372548 AAACTAGGTGTTAAGAATATAGG - Intergenic
1196259864 X:113565910-113565932 TAAACAGGGGGTGAGGAAATGGG + Intergenic
1197126191 X:122948956-122948978 AGACCAGGTGTTGGGGATTTGGG + Intergenic
1197780581 X:130155546-130155568 ACATCAGGGGATGAGGATATAGG + Intronic
1198617058 X:138470061-138470083 AAACCAGGTGTGAAGCATATGGG + Intergenic