ID: 1003810002

View in Genome Browser
Species Human (GRCh38)
Location 6:9768557-9768579
Sequence CAGAGTCCAGAGATGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003810002_1003810008 30 Left 1003810002 6:9768557-9768579 CCTAATTCCATCTCTGGACTCTG 0: 1
1: 0
2: 1
3: 31
4: 279
Right 1003810008 6:9768610-9768632 ACAATCTTCTCCCCAAGACTTGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003810002 Original CRISPR CAGAGTCCAGAGATGGAATT AGG (reversed) Intronic
900552139 1:3262256-3262278 CAGAGTCCAGGGACGCAACTGGG - Intronic
900780141 1:4612569-4612591 CAGAGTCCAGGGATGGGGTTGGG + Intergenic
901077389 1:6563856-6563878 GAGAGTCGAGAGTGGGAATTTGG + Intronic
902986529 1:20157763-20157785 CAGAGTGAAAAGATGGAAGTTGG + Intergenic
903643970 1:24879686-24879708 CAGAGTCCTGAGATGGCTCTGGG + Intergenic
904037493 1:27566728-27566750 CAGAGGACAGAAATGGAATGTGG + Intronic
904550279 1:31310919-31310941 CATAGACCAGAGATATAATTAGG - Intronic
905289145 1:36909636-36909658 CAGAGCCCAGTGATGCAAATGGG - Intronic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
907049941 1:51323205-51323227 CAGAGGCCAGAGAAGGGATGTGG - Intronic
908555527 1:65253863-65253885 CAGAGACCAGTGATGGCATGGGG + Intronic
910494611 1:87812560-87812582 GAGAGTTCAGAGGTAGAATTTGG + Intergenic
912380631 1:109246339-109246361 CAGAGCCCAGAAATGGGATCGGG + Intergenic
914241723 1:145857334-145857356 CAGAGTCCAGGGATGGAGGCGGG - Intronic
917954995 1:180086138-180086160 CACAATACAGAGATGGAATAGGG + Intronic
919075053 1:192803202-192803224 CAGAGTCCATAGTTGACATTAGG - Intergenic
919644365 1:200079223-200079245 CAGAGATCAAAGATGGGATTCGG - Intronic
920634279 1:207684032-207684054 CAGATTGCACAGAAGGAATTCGG - Intronic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921436716 1:215131808-215131830 CGGAGTGTAGAGATTGAATTTGG + Intronic
921612477 1:217228727-217228749 CAGAGTCCAAAAATGCATTTAGG - Intergenic
921627299 1:217390979-217391001 CAGAGTCCAGAGTTTGTGTTAGG - Intergenic
921651422 1:217683340-217683362 CAGAGACCAATGATGCAATTAGG + Exonic
921760969 1:218914575-218914597 CATAGACCAGATATGGAATTCGG + Intergenic
922003078 1:221501063-221501085 CAGAGTCTAGAGGTGTTATTTGG + Intergenic
922879986 1:228973616-228973638 CAAATTCCACAGGTGGAATTTGG - Intergenic
923241111 1:232086572-232086594 GAGAGTCCAGAGAAGTAATAAGG - Intergenic
1063061233 10:2555599-2555621 CAGACTCCAGAGAAAGAACTTGG - Intergenic
1063999243 10:11649622-11649644 CTCAGTCCAGAGATGGAGTTGGG - Intergenic
1064482924 10:15757404-15757426 CAAAGTCCAGAGTTGACATTAGG + Intergenic
1065615241 10:27514542-27514564 CAGAGTCTAGAAATGGAAAAAGG + Intronic
1067774704 10:49154535-49154557 CAGAGTCCAGTGGTGGTGTTGGG + Intergenic
1069852648 10:71420092-71420114 CAGAGTCCAGAAATCCAAATAGG + Intronic
1070137291 10:73706155-73706177 CAGAGTCCAGAGATCTCATATGG - Intergenic
1070324390 10:75378405-75378427 CAGTGACCAGAGATGCAATCTGG - Intergenic
1072263030 10:93700641-93700663 CATATTCCAGAGAGGAAATTTGG - Intronic
1072856197 10:98949526-98949548 CAGAGTTTACAGATGGAATCAGG + Intronic
1074031222 10:109690491-109690513 CAGAGCTCAGAGATGGTCTTAGG + Intergenic
1075795066 10:125114399-125114421 CAGCACCCAGAGATGGATTTGGG + Intronic
1075855236 10:125624359-125624381 CAGAGACCAGAGAAGAAAGTGGG + Intronic
1075943342 10:126410023-126410045 CAGAGTGCCCAGGTGGAATTAGG - Intergenic
1076021604 10:127078022-127078044 CAGAGCCGAGAAAAGGAATTTGG + Intronic
1077336804 11:2008940-2008962 CAGAGTTCAGAGTTGGAAAGGGG + Intergenic
1077725856 11:4674330-4674352 CAGAGCCCTGGAATGGAATTTGG - Intergenic
1077800344 11:5530149-5530171 CAGGGTCCAGAGAAGCCATTAGG - Intronic
1078925584 11:15871981-15872003 CAGAGCTCAGAGATGGAGCTTGG + Intergenic
1079875826 11:25856091-25856113 CAGAGTCCAGAGATGGCACGTGG - Intergenic
1080409059 11:32006169-32006191 CACCGTCCAGAGATGGAAACTGG - Intronic
1080533283 11:33197578-33197600 CAGAGCCAGGAGATGGAATCAGG + Intergenic
1080868777 11:36218261-36218283 AAAAGTCCAGAGTTGGAATGAGG - Intronic
1084422994 11:69069930-69069952 CAGAGGCAAGAGATCGAATTTGG + Intronic
1084438257 11:69156483-69156505 GAGAGGCCAGAGCTGGACTTGGG + Intergenic
1085041685 11:73330659-73330681 CACAGTACAGACAAGGAATTTGG - Intronic
1086169049 11:83814925-83814947 CACAGTCAAGAAATGGAAATGGG + Intronic
1087813191 11:102630820-102630842 CAGGGTGCAGAGCTGGAATATGG + Intergenic
1088463965 11:110113181-110113203 AAGAGTCGATAGATAGAATTTGG + Intronic
1089050384 11:115540256-115540278 CAGTGTCCAGGGCTGGAACTGGG + Intergenic
1089865063 11:121624440-121624462 CAGAGTCCAGGGCTGTAACTAGG + Intronic
1089914713 11:122142424-122142446 GACAGTGCAGAGATAGAATTGGG + Intergenic
1089956761 11:122578438-122578460 CAGTGTCCAGAGATTTTATTGGG + Intergenic
1090274527 11:125410214-125410236 GAGACTCCGGACATGGAATTGGG - Exonic
1202819788 11_KI270721v1_random:64122-64144 CAGAGTTCAGAGTTGGAAAGGGG + Intergenic
1091607520 12:1967891-1967913 CAGTGTCCATCTATGGAATTTGG - Exonic
1092049347 12:5456736-5456758 CAGAGCCCAGAAACAGAATTTGG - Intronic
1092785621 12:12023905-12023927 AAGCATCCAGAGATGGAAATGGG + Intergenic
1093706430 12:22279614-22279636 CAGAATGCAGAGATGAAAATGGG - Intronic
1093821569 12:23625533-23625555 ATGAGTCAAGAGCTGGAATTGGG - Intronic
1094753106 12:33437489-33437511 CAGATTTCAGAGCTGGGATTTGG + Intronic
1095302321 12:40598970-40598992 GAAATTCCAGAAATGGAATTTGG - Intergenic
1095370316 12:41459014-41459036 CAGAGTTCAAAGGAGGAATTAGG + Intronic
1095449587 12:42316052-42316074 CAGAGTCCAGAGGTAGTAATGGG - Intronic
1095923838 12:47558623-47558645 GAGAGTCCAGAGAGGAAATCAGG + Intergenic
1097703532 12:62845020-62845042 CAGAAGCCAGAGGTGGAATTTGG - Intronic
1098462083 12:70742987-70743009 CAGAGTTCAGAGCTGAAATATGG + Intronic
1101726504 12:107392635-107392657 GGGAGAACAGAGATGGAATTTGG - Intronic
1102213829 12:111146198-111146220 CAGAGTCCACAGTTGACATTAGG + Intronic
1104534208 12:129603160-129603182 CAAAGTCCAAAGTTGGCATTAGG + Intronic
1104977859 12:132560245-132560267 CGGACTCCAGAGAGGGAATTGGG + Intronic
1105243193 13:18625723-18625745 CAGAGTCCAGAGCAGGACATGGG - Intergenic
1105942132 13:25156977-25156999 CAGCGTCCAGAGATTCTATTAGG + Intergenic
1109285687 13:60405653-60405675 CAGTGTAGTGAGATGGAATTAGG + Intronic
1111231824 13:85354202-85354224 CAGAGTGCAGAGGTGTAAGTAGG - Intergenic
1111935277 13:94550875-94550897 CAGAGTTCAGAGAAGGGTTTGGG + Intergenic
1113435768 13:110289883-110289905 CAGATCCCAGAGACGGAATGAGG + Intronic
1113453958 13:110434055-110434077 CAGAGTCCAGGGAGTGAAATGGG + Intronic
1113489755 13:110682050-110682072 CAGAGACCAGAGTTGGCATCAGG - Intronic
1115220484 14:31053454-31053476 CAGAGGCCAGAGAAGGAATGGGG + Intronic
1115521474 14:34236915-34236937 CAGATTCCAGAGCTGAAAGTTGG - Intronic
1116429732 14:44831997-44832019 CAGAGTCCATAGTTTGCATTAGG + Intergenic
1117442173 14:55770291-55770313 AAGAGTTCAGAGATGGAAGATGG + Intergenic
1117478828 14:56122668-56122690 TAGGGTCCACAGATGGAGTTCGG + Intronic
1119178304 14:72586127-72586149 CTGAGTCCAGAGATAGGAGTGGG - Intergenic
1119553509 14:75535359-75535381 CAGAGTGCAGTGATGTAATCAGG - Intronic
1120674153 14:87400706-87400728 CAGAGTCCAGAGAATTAAGTTGG - Intergenic
1120795937 14:88632821-88632843 CAGAGTCCAGAGTTTTTATTGGG - Intronic
1122703739 14:103607483-103607505 CAGACTCCAGAGCTGGAACCTGG + Intronic
1123488093 15:20758905-20758927 CAGAGTCCAGAGCAGAAACTGGG + Intergenic
1123544593 15:21327978-21328000 CAGAGTCCAGAGCAGAAACTGGG + Intergenic
1123776986 15:23590014-23590036 CAAAGCCCAGAGAGGCAATTAGG - Intronic
1123818125 15:24000093-24000115 CAAAGTCCAGAGAGGCAATTAGG - Intergenic
1124090921 15:26599249-26599271 CACATTCCAGAGATGGAAAGGGG + Intronic
1124354486 15:28984766-28984788 CAAACTCCAGAGATGGCAGTGGG - Intronic
1124581886 15:30963217-30963239 CACCGTCCAGTGATGGAAGTAGG - Intronic
1125330759 15:38580019-38580041 CAGAGTCCACAGATTACATTAGG - Intergenic
1125672972 15:41486695-41486717 CAGAGCTCACAGATGGAATTAGG + Intergenic
1125927782 15:43577314-43577336 AGGAGACCAGAGATGTAATTTGG + Intronic
1125940925 15:43676879-43676901 AGGAGACCAGAGATGTAATTTGG + Intergenic
1126056417 15:44734032-44734054 CAAAGTAGAGAGAAGGAATTTGG + Intronic
1126207625 15:46063056-46063078 CAGAGTCCAGAAGTGGTAGTAGG - Intergenic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1128280548 15:66390518-66390540 CCCAGTTCAGAGATGGAGTTGGG + Intronic
1128546126 15:68569150-68569172 CAGAGTCCAGAGTTTACATTAGG + Intergenic
1130009856 15:80142624-80142646 CAGAGTGCAGAGTGGGAATCAGG + Intergenic
1130764888 15:86859846-86859868 TAAACTCTAGAGATGGAATTAGG - Intronic
1131743853 15:95423424-95423446 CAAAGTCCACAGTTGAAATTAGG - Intergenic
1134323493 16:13185653-13185675 CAGAGTCCAGTGAGGGAAACAGG - Intronic
1135037874 16:19093381-19093403 CAGAGTCCCGAGATGGCACAGGG - Intergenic
1135847900 16:25935329-25935351 CAGAGTCCATAGTTTGCATTAGG + Intronic
1137015572 16:35370933-35370955 AACAGTCCAGAGTTAGAATTGGG - Intergenic
1137885725 16:52101536-52101558 CAGAGTCAAGAAATGGTTTTGGG + Intergenic
1137894715 16:52198945-52198967 CAGAGTCCACAGGTGACATTAGG - Intergenic
1138529035 16:57625143-57625165 CGGAGTCCAGAGATGGTGTGGGG - Intronic
1139054803 16:63169947-63169969 CAGAGTCCATAGTTTGCATTAGG + Intergenic
1139644759 16:68320316-68320338 TAGAGTGCAGAGTGGGAATTGGG + Intronic
1140284990 16:73594601-73594623 TAGAGTCTAGAGGTGGAGTTGGG + Intergenic
1141371821 16:83494617-83494639 CAGTGTCCAGAGCAGGAACTGGG + Intronic
1141568552 16:84920132-84920154 CAGAGCCCAGAGCTGTCATTAGG + Intronic
1141750615 16:85955544-85955566 CAGAGGCCAGGGATGGATTTTGG + Intergenic
1142504162 17:352343-352365 CAGTGGACAGAGATGGATTTGGG - Intronic
1144152614 17:12464752-12464774 CAGAGTTCAGAGTTGACATTGGG + Intergenic
1144674012 17:17150234-17150256 GTGAGTCCAGGGATGGAAGTGGG + Intronic
1145088637 17:19967196-19967218 CAGTGTACAGAGATTGAAGTGGG - Intronic
1149036699 17:52142157-52142179 CAGAATCCTGAGTTGGAAATTGG + Intronic
1149154225 17:53607189-53607211 CAGGGGCCAGAGATGAAAATAGG + Intergenic
1151373672 17:73667422-73667444 CAGTGTCCAGAGGTGGCACTAGG - Intergenic
1153767901 18:8392127-8392149 CAAAGTCCACAGATTGGATTTGG - Intronic
1153909411 18:9693749-9693771 CAGAATCCAGAGTTGGAAAGGGG + Intergenic
1154047861 18:10924112-10924134 CAGAGTGGAGAGCAGGAATTGGG - Intronic
1158285611 18:55878242-55878264 CTGATTCCAGAGTTGGAATCTGG - Intergenic
1161164097 19:2776504-2776526 CAGAGACCAAAAGTGGAATTGGG + Intronic
1162909952 19:13843145-13843167 CAGGGTCCAGAGGGGGAAGTTGG - Intergenic
1163078753 19:14920137-14920159 CAGAGCCCAGAGATTGCAGTGGG + Intergenic
1163781486 19:19251625-19251647 CAGAGTCCAGAGCAGGATTTGGG - Exonic
1164097786 19:22027243-22027265 CACAGTCTACAGGTGGAATTGGG - Intergenic
1164230755 19:23285716-23285738 CAGAGTGCAGAGTGGGAATCAGG - Intergenic
1165283229 19:34815631-34815653 CAGAGTCCATGAATGGAAATGGG - Intergenic
1165539805 19:36483435-36483457 CTGAGCCCAGAGATGGAAGAGGG + Intronic
1166300654 19:41910357-41910379 CAGCATCCAGAGGTGGAGTTGGG + Intronic
925584306 2:5447976-5447998 CAAATTGCAGAGATGGAATGAGG - Intergenic
927475425 2:23410895-23410917 TTGAGTACAGAGATGGAACTTGG + Intronic
928285430 2:29986167-29986189 CAGAGACCAGAGATGAAAATGGG + Intergenic
928865732 2:35915761-35915783 CACACTGCAGAGAGGGAATTAGG - Intergenic
929298242 2:40272186-40272208 GAGAGACATGAGATGGAATTGGG - Intronic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
932446079 2:71782438-71782460 CAGAGAGCAGAAATGGAAGTAGG + Intergenic
933798231 2:85938268-85938290 TAGAAACCAGAGATGGAATAAGG - Intergenic
936463675 2:112728924-112728946 AAGAGTCCAGAGATGAGATGAGG - Intronic
936780246 2:116023896-116023918 CAGAGCCAAGAGATTGAAATGGG - Intergenic
936835428 2:116703810-116703832 CAGGGTCCTGTGATGGAAGTTGG - Intergenic
936968428 2:118150348-118150370 CTGAGTCCAGAGAAGAAATCTGG - Intergenic
941081677 2:161068709-161068731 CAGAGTCCAGATATATAAGTAGG + Intergenic
943751593 2:191514963-191514985 GAGAGTTCAGAGATGGAAAGGGG + Intergenic
946343774 2:219091165-219091187 GAGAGTCCTCAGCTGGAATTGGG - Intronic
948044859 2:234935797-234935819 CAGAGTCTAGAGGTGGCAGTGGG - Intergenic
949039560 2:241841524-241841546 CAGGGTCCACAGCTCGAATTGGG - Intergenic
1169776350 20:9258382-9258404 AAGAGTCCAGAAATGGGAGTGGG + Intronic
1170334809 20:15257351-15257373 CAGAGTCATGAAATTGAATTCGG + Intronic
1170477421 20:16729849-16729871 AAGAGTCCGGAAATGGAAATGGG - Intergenic
1170506831 20:17035267-17035289 AAAAGTTCAGAAATGGAATTAGG + Intergenic
1170550861 20:17474845-17474867 CTGAGCCCACAGATGGAATGAGG + Intronic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1172094046 20:32452121-32452143 CAGAGGCCAGTGATGGAAAGGGG - Intronic
1172571553 20:35974751-35974773 CACACTCCAGACACGGAATTGGG + Intronic
1173297884 20:41775409-41775431 CAGACCGCAGAGATGGAAGTTGG + Intergenic
1175164814 20:57035962-57035984 CACAGTACAGAGGTGGAACTTGG - Intergenic
1175808164 20:61842686-61842708 CAGATTCCAGAGCTGTAGTTAGG - Intronic
1176450244 21:6855688-6855710 CAGAGTCCAGAGCAGGACATGGG - Intergenic
1176828413 21:13720706-13720728 CAGAGTCCAGAGCAGGACATGGG - Intergenic
1177938769 21:27382781-27382803 CAGAGTCCAAAGTGGGATTTTGG - Intergenic
1178499341 21:33112802-33112824 CAGCTTCCAGAGAAGGATTTAGG + Intergenic
1181975775 22:26728500-26728522 CAGAGTCCAGAGATTGGCTCAGG - Intergenic
1184318911 22:43723848-43723870 CAGAGTCCGGAGATGGCCCTGGG + Intronic
1184346680 22:43917908-43917930 CAGAGTGGAGAGATGGGTTTGGG - Intergenic
1184363438 22:44032710-44032732 CAGAGTCCAGAGCTGGTACGTGG + Intronic
1185088024 22:48751110-48751132 CAGGGACCAGAGAGGGAATCAGG - Intronic
949169363 3:980406-980428 CAGAGTCCAGAGGAGGATTGTGG + Intergenic
950009814 3:9715103-9715125 CAGTGTCCAGAGAGACAATTGGG - Intronic
952531332 3:34265194-34265216 CTGAGCACAGAGCTGGAATTTGG + Intergenic
953063081 3:39443860-39443882 CAGAGGCCAGAACTGGAATGGGG + Intergenic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961795477 3:129405806-129405828 CAGTGGTCAGAGATGGATTTGGG + Intronic
963893370 3:150660186-150660208 CAGAGTCCAGAAGTGGAACTGGG + Intronic
963906313 3:150776202-150776224 CAGGGTCCACAGATTGCATTTGG + Intergenic
963924606 3:150938304-150938326 CAGAGGCCAGAGACTGTATTGGG - Intronic
964442838 3:156729627-156729649 CAGCGTCCAGAGAGGGAGTTGGG + Intergenic
965886978 3:173458016-173458038 CAGAGTACAGAGATGAATTAAGG + Intronic
966511357 3:180766753-180766775 CAGAGTGCAGAGTGGGAATCAGG - Intronic
966551644 3:181211646-181211668 CATAGTCCAGATATAGAGTTGGG - Intergenic
969496834 4:7531030-7531052 CAGAGTCCAGAGAGGGAAAGAGG + Intronic
970331559 4:14990976-14990998 CAGAGACCAGTTATGCAATTAGG - Intergenic
970959341 4:21854791-21854813 CAGAGTCCAAAGAAGAAATAGGG - Intronic
971117379 4:23664136-23664158 CAGAGTCCCAAGATGGCCTTGGG - Intergenic
971401564 4:26280428-26280450 CATTGTCCAGGGATGGAATGGGG - Intronic
971490533 4:27207753-27207775 CAGTATCTAGAGATGGAATCAGG + Intergenic
973631787 4:52826446-52826468 CACAGTGCAGAGAATGAATTGGG - Intergenic
975163505 4:71150674-71150696 AAGTGTGCAGAGATGGAAATGGG + Intergenic
975497475 4:75050806-75050828 AAGAGTCAAGATATGGAATGAGG + Intergenic
975947521 4:79725414-79725436 CAGAGTACAGTGGTGGAATCTGG + Intergenic
976826617 4:89267628-89267650 CAGAAGCCAGAGATGGACTGGGG - Intronic
977056250 4:92195658-92195680 CAGAGTCCATAGATTACATTAGG - Intergenic
977898195 4:102387840-102387862 CAGATTTCAGAGTTTGAATTAGG - Intronic
978260534 4:106752265-106752287 CAGAGTCTAGAGTTGCATTTTGG + Intergenic
979018897 4:115469082-115469104 CAGAGTCCAGAGGTGGCAGGGGG - Intergenic
979115055 4:116813080-116813102 CAGAGTCCATAGTTAGCATTAGG + Intergenic
980467087 4:133200752-133200774 CAGAGTCAAGAGAAAGGATTAGG - Intronic
980743971 4:136991402-136991424 CAGAACCAAGAGATGGAAGTAGG - Intergenic
980773131 4:137404597-137404619 CACAATTAAGAGATGGAATTGGG - Intergenic
981537603 4:145816023-145816045 CAAAGTCCTCAAATGGAATTTGG + Intronic
981709119 4:147691544-147691566 CAGAGTTCAGAGATGATATGAGG + Intergenic
981780347 4:148422463-148422485 CAGGGTATAGAAATGGAATTGGG - Intronic
983386150 4:167064756-167064778 CAGAGTCCTGTGATGAAAGTTGG + Intronic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
983860381 4:172698548-172698570 CAGAGTATAGAGCTGCAATTTGG - Intronic
988696681 5:33628274-33628296 GAGAGTTCAGAGCTGGAAGTGGG + Intronic
991338399 5:65576909-65576931 CAGTTACCAGACATGGAATTTGG + Exonic
995683453 5:114745590-114745612 CAGAGTGAAGAGTTGAAATTCGG + Intergenic
996334173 5:122365174-122365196 AAGAGTCCAGACAGGGAATTAGG - Intronic
998413218 5:141926851-141926873 CAGAGCACAGGGATGGCATTGGG - Intronic
998823839 5:146081449-146081471 CAGAGTCCAGAGCTTGACTTGGG + Exonic
999497618 5:152115552-152115574 CACAGTCCTGAGATGGCAGTGGG - Intergenic
999841145 5:155428488-155428510 CAGAGTCCATAGTTTGCATTAGG + Intergenic
999926164 5:156380787-156380809 CAGAGCCCAGAGATGTATATAGG + Intronic
1000082509 5:157861293-157861315 AAGATCCCAGAGATGGAATGTGG + Intergenic
1001599684 5:172920753-172920775 CAGAGTTCAGAACTGGGATTGGG - Intronic
1001692362 5:173642566-173642588 CAAAGCCCAGAGATGGGAGTCGG + Intergenic
1001922432 5:175611117-175611139 AACTGTCCAGAGATGGGATTGGG - Intergenic
1001994746 5:176147547-176147569 CAGAGTCCCAAGAAGGAACTCGG - Intergenic
1003810002 6:9768557-9768579 CAGAGTCCAGAGATGGAATTAGG - Intronic
1005250076 6:23935279-23935301 CAGAGCCCAGGGATGGGAGTGGG + Intergenic
1008037876 6:46765114-46765136 CAGAGGACAGAGCTGGAACTTGG + Intergenic
1008251115 6:49240888-49240910 CAGAGTCTACTGATGGAATTAGG - Intergenic
1010833807 6:80562538-80562560 CAGAGTCCAGAGTTTTTATTTGG + Intergenic
1013036829 6:106393197-106393219 CAGAGTTCTGAGATGGAACATGG + Intergenic
1015514212 6:134068777-134068799 CAGAGTCCAGAGCTCACATTAGG - Intergenic
1016427175 6:143947299-143947321 CAGAGTCCAGGGATGAAATGTGG - Intronic
1016427451 6:143949497-143949519 CAGAGTCCAGGGATGAAATGTGG - Intronic
1016629623 6:146213281-146213303 GAGTGTCCAGAGATGAGATTGGG + Intronic
1017223588 6:151994408-151994430 CAGAGACCAGAGATCGTATTTGG - Intronic
1017841468 6:158226058-158226080 CAGAGTCAAAAGATAGAAGTGGG + Intergenic
1019567009 7:1688851-1688873 CAGAGGTCAGAGATGGGATGGGG - Intronic
1019823277 7:3262215-3262237 CAGAGTCCAGAGTTTACATTAGG + Intergenic
1020824237 7:13007464-13007486 CAGAGACCACAGAAGGAATTTGG - Intergenic
1021038902 7:15836832-15836854 CAGAGTTGAGAGAAGGCATTAGG + Intergenic
1021191181 7:17621509-17621531 CATAGTCCAGAAATGTAATGAGG - Intergenic
1021297210 7:18922682-18922704 CAAAGTCCAGAGATGGGAATTGG + Intronic
1021484219 7:21149112-21149134 CAGAGTCCTCTCATGGAATTTGG + Intergenic
1021956615 7:25831519-25831541 CAGAGTCCAGACAAGTATTTTGG - Intergenic
1022623484 7:32009286-32009308 CTGAGTCAGGAGATGGAGTTGGG + Intronic
1023472678 7:40541705-40541727 AAGAGTCTAGAGATTGGATTGGG + Intronic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1031285753 7:119865797-119865819 CAGAATCCAGAGTTGGAAGTGGG - Intergenic
1031669561 7:124526093-124526115 CAGAGGGCAAAGATGGAACTGGG - Intergenic
1032565829 7:132941807-132941829 CAGATTCCACAGGTGGACTTGGG - Intronic
1033242777 7:139694502-139694524 CAGAGACCAGAGGTGGATCTGGG - Intronic
1033402691 7:141041990-141042012 CAGAGTCCAGAGTTTGCATTAGG - Intergenic
1034099865 7:148441681-148441703 CAGAGTCCAGAAATGGGATGGGG + Intergenic
1034659097 7:152753669-152753691 CAGAATCCAGAGATGAAATCTGG - Intergenic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1037223656 8:16556100-16556122 CACAGTCCACAGATGTAAATAGG + Intronic
1039218549 8:35301127-35301149 CTGATTCCAGAGATGGAACAGGG + Intronic
1043199821 8:77352876-77352898 CACAGGCCAGAGATGGAGTTTGG + Intergenic
1044207098 8:89503262-89503284 CAGATTCTAGAGATTGTATTGGG + Intergenic
1045258405 8:100549705-100549727 CAGAGTCCATAGTTTGCATTAGG + Intronic
1047342366 8:123994428-123994450 AAGAGTCCAGAGAAGGAGTGGGG + Intronic
1047553309 8:125900508-125900530 CAGAGTCCTGAGATGGCACAGGG - Intergenic
1048337980 8:133517186-133517208 CAGAATCCAGAGAAGGACTGGGG - Intronic
1048474788 8:134733445-134733467 TTGAGGCCAGAGATGGAATGGGG + Intergenic
1048702567 8:137109390-137109412 CAAAGTCCAGAGAAACAATTGGG + Intergenic
1050169021 9:2796088-2796110 TGGTGTCCAGAGATGAAATTTGG - Intronic
1050355880 9:4782258-4782280 CAGAGACCAGTCATGGAATCAGG - Intergenic
1051349512 9:16185635-16185657 CACATTTCAGAGAGGGAATTAGG + Intergenic
1052866297 9:33466477-33466499 CAGAGTCAGGAGTTGGAAGTGGG + Intronic
1055857433 9:80707151-80707173 CAGTGTCCAGAGATTTTATTGGG + Intergenic
1055883581 9:81032248-81032270 CAAAGTTCAGAGATGGCCTTTGG - Intergenic
1056943365 9:90973951-90973973 AAAAGTCCATAGATGGAATTTGG + Intergenic
1058120433 9:101132639-101132661 CAGAGTCCATAGATTACATTAGG - Intronic
1059289935 9:113213691-113213713 CAGGGTCCTGAGATGGCATGGGG - Intronic
1059585004 9:115596452-115596474 CTGGGTTCAGAGATGGAACTTGG + Intergenic
1059814758 9:117900011-117900033 TAGAATCTATAGATGGAATTTGG - Intergenic
1061287165 9:129630617-129630639 AAGAGTCCACATATGGAACTCGG - Intronic
1061816912 9:133202875-133202897 TTGAGTCCAGACATGGAGTTAGG + Intergenic
1062078875 9:134608190-134608212 CAGAGTCCAGAGTTTACATTAGG + Intergenic
1062112087 9:134787596-134787618 CACAGACCAGAGATGGATTTAGG - Intronic
1203518938 Un_GL000213v1:28829-28851 CAGAGTCCAGAGCAGGACATGGG + Intergenic
1185926012 X:4147223-4147245 CAGCGACCAAAAATGGAATTTGG + Intergenic
1188635311 X:32422703-32422725 CAGTGTCCCTAGATGGAATGAGG - Intronic
1192330951 X:70174822-70174844 CACAGTCCAGTGTTGGAAGTAGG - Intergenic
1192534616 X:71916698-71916720 TGGCGTCCAAAGATGGAATTTGG + Intergenic
1192620303 X:72672438-72672460 CAGAGTCCCAAGGTGGAATGGGG + Intronic
1194476896 X:94369543-94369565 AAGAGTCAAGTCATGGAATTGGG - Intergenic
1194977149 X:100407609-100407631 CAGTGTGCCGGGATGGAATTGGG + Exonic
1195375588 X:104224441-104224463 CAGAGGCCAGAGAGGGGAGTTGG + Intergenic
1195448219 X:104977542-104977564 GAGAGAGCAGAGATGGAAATTGG - Intronic
1200411763 Y:2868283-2868305 CAGAGTGCAGAGATGGTATTGGG + Intronic
1201867875 Y:18673768-18673790 CGGAGACTAGAGATGGAAGTAGG - Intergenic
1202260993 Y:22970073-22970095 TAAAGTACAAAGATGGAATTGGG + Intergenic
1202266828 Y:23028361-23028383 CAGAGTCCAGAGTTCACATTTGG + Intergenic
1202413981 Y:24603814-24603836 TAAAGTACAAAGATGGAATTGGG + Intergenic
1202419821 Y:24662106-24662128 CAGAGTCCAGAGTTCACATTTGG + Intergenic
1202450965 Y:25007978-25008000 CAGAGTCCAGAGTTCACATTTGG - Intergenic
1202456803 Y:25066272-25066294 TAAAGTACAAAGATGGAATTGGG - Intergenic