ID: 1003812363

View in Genome Browser
Species Human (GRCh38)
Location 6:9798948-9798970
Sequence GTATGCATACTGGTTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003812363 Original CRISPR GTATGCATACTGGTTGAGAT TGG (reversed) Intronic
902236725 1:15062433-15062455 GCATGCACACCTGTTGAGATGGG - Intronic
903782809 1:25832872-25832894 GTATGTATACTGCTTGTGTTTGG + Exonic
905747341 1:40429604-40429626 GAATGTATACTGGTTTAGAATGG - Intergenic
906896503 1:49778890-49778912 TATTGCATACTGGTGGAGATTGG - Intronic
908685769 1:66717691-66717713 GTATGCATAAAGTTTAAGATTGG - Intronic
914007766 1:143747799-143747821 GTATAAATACTGTTTGAGGTGGG + Intergenic
914685098 1:149971322-149971344 ATTTGCATACTGGTTTTGATAGG - Intronic
1064406194 10:15065894-15065916 GTATGTATACTGGTTTAGAATGG + Intronic
1067998454 10:51303069-51303091 GTTTGAAAACTGGTTAAGATTGG + Intronic
1068577927 10:58705754-58705776 TATTGCATACTGGTGGAGATTGG + Intronic
1075744561 10:124717705-124717727 GTATGCATAAGGATTGAGCTTGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1079588293 11:22152253-22152275 GTCTGAATGCTGGTTCAGATAGG - Intergenic
1080437429 11:32258533-32258555 GAAAGCATAGTGGTTGATATAGG - Intergenic
1083049977 11:59768458-59768480 ATATGAATATTGGTTGTGATTGG + Intronic
1085120839 11:73966380-73966402 GTCTGCAGAGTGGGTGAGATGGG + Intronic
1093843193 12:23931273-23931295 GTATGTAAACTGTTTGAAATTGG - Intronic
1097561416 12:61210813-61210835 GTATTCATACTACTTGACATAGG - Intergenic
1098116995 12:67189692-67189714 GAATGGATACTGGGTGAGGTGGG + Intergenic
1098955492 12:76685347-76685369 GTTTGCTTCCTGGTTGCGATGGG + Intergenic
1102056972 12:109903923-109903945 GCATGCATGCTGGGTGAGAGGGG - Exonic
1109247221 13:59970109-59970131 GTATGCATAGTGCTTGACTTGGG - Intronic
1111042193 13:82763065-82763087 TATTGCATACTGGTGGAGATTGG - Intergenic
1111572213 13:90103780-90103802 GTGTGCATAGTGGTTCAGATTGG + Intergenic
1118856003 14:69622968-69622990 ATATGCATACTGGTTGCCAAAGG - Intronic
1135533635 16:23275818-23275840 GGATTCATAATGGATGAGATGGG + Intergenic
1135720476 16:24813248-24813270 TATTGCATACTGGTGGAGATTGG + Intronic
1140983332 16:80132786-80132808 TAATGCATACTGGTGAAGATGGG + Intergenic
1143041308 17:4039237-4039259 GTGGGCAGACTGCTTGAGATCGG + Intronic
1143674343 17:8420649-8420671 GTATGAATGCTGGTTGACAGGGG + Intronic
1147358544 17:39916739-39916761 GTTTGCTTACTGGTTAAGAAAGG - Intronic
1149941775 17:60877810-60877832 GTTTGCATACTGGCTGTCATGGG + Intronic
1151873129 17:76850163-76850185 GTATCCTTACTGGTGGAGAGCGG - Intergenic
1153014509 18:571438-571460 GTGGGCAAACTGGTTGAGGTCGG + Intergenic
1161432997 19:4244893-4244915 GTATGTATACTTTTTGAGACAGG - Intergenic
1164781129 19:30893955-30893977 CTGTGCATACTGGTTGTCATTGG - Intergenic
1165665161 19:37621882-37621904 GGATGCATTCTGGTGGGGATTGG - Intronic
931690756 2:64832800-64832822 GTTTGAATACGGTTTGAGATGGG + Intergenic
934773380 2:96921944-96921966 GTATTCTTACAGGATGAGATAGG + Intronic
936452102 2:112641500-112641522 ATATGGAGACTGGTTGAGACTGG - Intergenic
939859868 2:147406542-147406564 TATTGCATACTGGTGGAGATTGG - Intergenic
939892195 2:147749694-147749716 GTAGGCTTACTGGTGGAGCTGGG + Intergenic
939944308 2:148390579-148390601 ATATACATACTTTTTGAGATGGG + Intronic
943888750 2:193257806-193257828 CTATGCTTTCTGGTTGAAATGGG - Intergenic
946574443 2:221058762-221058784 TATTGCATACTGGTAGAGATTGG + Intergenic
948527239 2:238578770-238578792 CTATGGATACTGGGTGACATTGG - Intergenic
951352599 3:21624694-21624716 GTCTGCATGCTGCTTGAGTTGGG - Intronic
953091996 3:39737412-39737434 GTATGCATTCGGGTTGATTTTGG + Intergenic
966173721 3:177112492-177112514 TTATGCATACAGATTGAGATCGG + Intronic
966791165 3:183671166-183671188 GTAGGCAAACTGTTTGTGATTGG + Exonic
979411296 4:120383151-120383173 TTAGGCATAATGTTTGAGATTGG - Intergenic
984564587 4:181312862-181312884 GGATGCATACTGCTTATGATGGG - Intergenic
987426654 5:17780516-17780538 GGATGGATGCTGGGTGAGATGGG + Intergenic
988965888 5:36417669-36417691 GCATGCATACTTCTTGAGAGGGG - Intergenic
996600352 5:125255249-125255271 GCAGGCATACTAGTTGACATGGG - Intergenic
998367852 5:141642444-141642466 TATTGCATACTGGTGGAGATTGG - Intronic
999837367 5:155388957-155388979 GAATGCATTTTGGTTGTGATGGG - Intergenic
1003812363 6:9798948-9798970 GTATGCATACTGGTTGAGATTGG - Intronic
1007262856 6:40575753-40575775 GCATGCATCCTGGTTGAGAGAGG + Intronic
1010817703 6:80378153-80378175 ATGTGCATAATGGTTGAGATTGG + Intergenic
1015085092 6:129280990-129281012 TTATGCATCCTGGTTGAAACAGG - Intronic
1020446617 7:8275586-8275608 GAATGCATAATGTTTGAGCTGGG - Intergenic
1021129181 7:16890545-16890567 GTATGCATAGTAGTTAAGAGTGG + Intergenic
1021673903 7:23061288-23061310 GTATGCATCATGAATGAGATAGG - Intergenic
1029920191 7:104254394-104254416 GTATGCAAAGTGCTTGAGTTGGG + Intergenic
1031418465 7:121520932-121520954 GTCTGCATACTGGTGAAGACTGG - Intergenic
1031668031 7:124509250-124509272 GTTTGCATGCTGTTTGAGAAAGG - Intergenic
1036673470 8:10809529-10809551 GTGTGAATAGTGCTTGAGATGGG - Intronic
1039616795 8:38961591-38961613 ATATGCCTACTGGTAGAGCTTGG + Intronic
1048277581 8:133078448-133078470 GTATGGAAAATGGTTGAGAGAGG - Intronic
1051245374 9:15105098-15105120 GTATGCAGACTGTTAGAGGTGGG + Intergenic
1055555449 9:77468911-77468933 GCATTCTTAATGGTTGAGATGGG - Intronic
1187671500 X:21670756-21670778 TAATGCATATTGGTGGAGATTGG + Intergenic
1189833141 X:44995379-44995401 GTATGTATACTGCTTGCCATTGG + Intronic
1193301948 X:79899659-79899681 GTATGCATAAGGGTTGGTATGGG - Intergenic
1196226316 X:113171303-113171325 GTATGTATACTGGTACAAATTGG + Intergenic