ID: 1003816480

View in Genome Browser
Species Human (GRCh38)
Location 6:9846970-9846992
Sequence CTGAGCAAAGATCACATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003816480_1003816485 19 Left 1003816480 6:9846970-9846992 CCTGGCATGTGATCTTTGCTCAG 0: 1
1: 0
2: 1
3: 30
4: 286
Right 1003816485 6:9847012-9847034 GCATTGTTCGCTATCTTGGGAGG No data
1003816480_1003816484 16 Left 1003816480 6:9846970-9846992 CCTGGCATGTGATCTTTGCTCAG 0: 1
1: 0
2: 1
3: 30
4: 286
Right 1003816484 6:9847009-9847031 TGAGCATTGTTCGCTATCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1003816480_1003816483 15 Left 1003816480 6:9846970-9846992 CCTGGCATGTGATCTTTGCTCAG 0: 1
1: 0
2: 1
3: 30
4: 286
Right 1003816483 6:9847008-9847030 TTGAGCATTGTTCGCTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003816480 Original CRISPR CTGAGCAAAGATCACATGCC AGG (reversed) Intronic
900079015 1:841796-841818 CTGAGCACAAACTACATGCCAGG - Intergenic
900106726 1:984517-984539 ATGAGCAACCATCGCATGCCGGG + Intergenic
900737298 1:4307072-4307094 CTGAGCTCACATCACATGCCAGG - Intergenic
902207049 1:14876414-14876436 CAGAGCAAAGAACAGATGCTTGG + Intronic
902566416 1:17314545-17314567 CTGAGCAGTTACCACATGCCGGG + Intronic
902619009 1:17639768-17639790 CTGAGCAACTGTCCCATGCCAGG + Intronic
902763943 1:18602224-18602246 CTGAGCACCTACCACATGCCAGG - Intergenic
904359985 1:29965027-29965049 CAGAGCAAAGACCACAGCCCAGG - Intergenic
904497858 1:30897437-30897459 CTGGGGAAAGATCAGATGGCTGG - Intronic
905397486 1:37676187-37676209 CTGGGAAAAGATGTCATGCCTGG + Intergenic
907579537 1:55559077-55559099 CTGAGGGAAGAACAGATGCCTGG - Intergenic
908072467 1:60477275-60477297 CTGAGGCAAGATCAAATTCCTGG - Intergenic
910984939 1:92996224-92996246 CTATGCAAAGATCTCATTCCAGG - Intergenic
911195544 1:94991138-94991160 TTGAGCAAAGATAATATGACAGG + Intronic
911515144 1:98859239-98859261 AAGAGTAAAGACCACATGCCAGG - Intergenic
911575228 1:99568768-99568790 GTGAGCACAGAACACATACCGGG + Intergenic
912478020 1:109954265-109954287 CTGTGAAAAAGTCACATGCCAGG + Intergenic
912727182 1:112068701-112068723 CTGAGCACCTATTACATGCCAGG - Intergenic
916743885 1:167669618-167669640 CTGAGCACCGAGTACATGCCAGG - Intronic
917934891 1:179856554-179856576 CTCAGAAAAGGTCACATGGCAGG + Intronic
917946671 1:179979974-179979996 CTGAGCAAAGAAAACAAACCTGG - Intronic
919409880 1:197229369-197229391 CTGAGCAAAGAGGAAATGCCAGG - Intergenic
921176717 1:212601677-212601699 CTGAGCACATACTACATGCCAGG - Intronic
921405217 1:214771683-214771705 CTGAGCAACTACTACATGCCAGG - Intergenic
922292879 1:224223354-224223376 CTGAGCAGAGAACAAAGGCCTGG - Intergenic
923449857 1:234106371-234106393 ATGAGAAAAGATCACAGGCTAGG + Intronic
923971550 1:239208421-239208443 GTGTGCAAAGATCACATGATGGG + Intergenic
923978271 1:239289628-239289650 CAGAGCAAACATCGCATCCCTGG + Intergenic
1063421276 10:5914534-5914556 CTGAGCAAACATCACAATGCTGG - Intronic
1065128735 10:22599508-22599530 CTGAGTAGAGAGCACTTGCCAGG - Intronic
1065357054 10:24852483-24852505 GTGAGCCATGATCACACGCCTGG - Intronic
1066125077 10:32333574-32333596 CTGAGCCAAGATCAAATCCAGGG + Intronic
1066413155 10:35193190-35193212 CTGAACATTTATCACATGCCAGG - Intronic
1066724897 10:38380787-38380809 ATGAGCACCGACCACATGCCAGG + Intergenic
1067765249 10:49081077-49081099 CAGAGCAAAGTTCACAGACCAGG + Intronic
1068860505 10:61842918-61842940 CTGAGCACTAATTACATGCCAGG + Intergenic
1069706570 10:70462448-70462470 CTGAGCATTGATTACATGCCAGG - Intergenic
1071062267 10:81586126-81586148 CTTAGCAAAGATTACAGACCAGG - Intergenic
1071431262 10:85608900-85608922 CTGAGCATAGTTCTCAGGCCAGG + Intronic
1071957297 10:90772793-90772815 CTGAGCATATGTAACATGCCAGG + Intronic
1073044924 10:100631474-100631496 CTTACCAAAGGTCACATGGCAGG + Intergenic
1073364611 10:102928369-102928391 CTGAGGTAAGATCACCAGCCTGG + Intronic
1073801719 10:107048528-107048550 CTTTGCAAATATCACATCCCTGG - Intronic
1073924466 10:108499126-108499148 GTGTGCAGAGATCACATGGCAGG + Intergenic
1075678380 10:124313815-124313837 CTGAGCACAGGTTACATGCCAGG - Intergenic
1078633888 11:13030921-13030943 CTGAACACCTATCACATGCCAGG + Intergenic
1078826030 11:14931068-14931090 CTTGGCAAAGGTCACATGACTGG - Intronic
1079271050 11:18986505-18986527 CTGAACACAGATCACATCACAGG - Intergenic
1079313334 11:19386449-19386471 CTGAGCACCTATTACATGCCAGG - Intronic
1079698975 11:23520300-23520322 CTGAGAAAACACCAAATGCCGGG + Intergenic
1080440388 11:32288924-32288946 GTGTGCAGAGATCACATGGCAGG - Intergenic
1081623285 11:44631831-44631853 CTGAGCACCTATTACATGCCAGG - Intergenic
1081706763 11:45186720-45186742 CTGAGCAATTATTATATGCCAGG + Intronic
1082105955 11:48222057-48222079 CTGAGCATATATTACATGCCAGG + Intergenic
1082901849 11:58263218-58263240 CTGAGCAAAAATCACAAAGCTGG - Intergenic
1083596718 11:63921118-63921140 CTGAGCAAATCTGACATCCCTGG + Intergenic
1084307872 11:68298594-68298616 GAGCCCAAAGATCACATGCCGGG - Intergenic
1084648083 11:70472422-70472444 CTGAGGAAAGGCCTCATGCCGGG + Intronic
1085197225 11:74680013-74680035 CTGAGCAAAGGCCACATCTCTGG - Intergenic
1085416264 11:76321030-76321052 CTAAGCATACATCAAATGCCAGG + Intergenic
1085525012 11:77159082-77159104 CTGAGAACAGAGCACATGTCGGG + Intronic
1086356442 11:86005900-86005922 CTGAGCAAAGGTAACTTGCCAGG - Intronic
1086901954 11:92377743-92377765 CTGAGCAGTGATCATATGCCAGG - Intronic
1087023359 11:93625090-93625112 CGGAGCACAGATCACATGCCAGG - Intergenic
1087369627 11:97266474-97266496 ATGTGCAGAGATCACATGGCAGG + Intergenic
1089925750 11:122255693-122255715 ATGTGCAGAGATCACATGGCAGG - Intergenic
1090263974 11:125342598-125342620 CTGAGAAAACAACACAGGCCGGG - Intronic
1090922983 11:131223430-131223452 CTGAGCAAGGATCTGGTGCCTGG - Intergenic
1091911003 12:4230647-4230669 CTGAGCACATATTACATGCCAGG - Intergenic
1093395345 12:18674447-18674469 GTGAGAAAATATCACGTGCCAGG - Intergenic
1095924833 12:47567968-47567990 TTAAGCATTGATCACATGCCAGG + Intergenic
1096253638 12:50050071-50050093 CTGAGCACCTATTACATGCCAGG - Intergenic
1097261200 12:57721109-57721131 GAGAGCAAATATCACAGGCCCGG - Exonic
1097303949 12:58048305-58048327 CTGAGCAAAAATAACAAGGCTGG + Intergenic
1097568739 12:61304740-61304762 CTTATCAAAGATTACATGACTGG - Intergenic
1100080972 12:90849564-90849586 TTGAGAAAATATAACATGCCAGG - Intergenic
1101688014 12:107045181-107045203 CTGAAGAAAGCTCACAGGCCAGG + Intronic
1101839773 12:108319898-108319920 CTGAGCACATATTACCTGCCAGG + Intronic
1102502153 12:113359967-113359989 CTGAGCACAGACCACATCCTGGG - Intronic
1102782883 12:115580759-115580781 TTGAGCACTGACCACATGCCAGG + Intergenic
1106849876 13:33778765-33778787 CTGAGCACCTACCACATGCCAGG + Intergenic
1108829514 13:54460018-54460040 CGGAGCATAAATCACTTGCCTGG + Intergenic
1109425905 13:62166196-62166218 CTGATCAAAGATCAAATCCAGGG - Intergenic
1110174747 13:72542487-72542509 CTGAGCAATTAACACATGCTGGG + Intergenic
1110340853 13:74388587-74388609 CTGAAGAAAGATCACATCACAGG - Intergenic
1111137073 13:84061577-84061599 CTGAGCAAAAAGCACAAGGCTGG - Intergenic
1112793710 13:103031300-103031322 TTGAGCAAATATCACATTCCAGG - Intergenic
1114430533 14:22656872-22656894 CTGAGCAAAGGCCACAGGGCTGG + Intergenic
1115478343 14:33837415-33837437 CTGAGCATTTATTACATGCCAGG - Intergenic
1117005848 14:51420091-51420113 CAGACCAAAGAGCACATGCCTGG - Intergenic
1117273407 14:54167921-54167943 CTGAGCACATAGCACATGCCAGG + Intergenic
1119114541 14:72007306-72007328 CTGAGCAAAGACCAAATTCAGGG + Intronic
1119401272 14:74364264-74364286 CTGAGCACAGCTTTCATGCCAGG + Intergenic
1119645361 14:76344205-76344227 TTGAGCACATAACACATGCCAGG - Intronic
1121484669 14:94305495-94305517 CTGAGCACATATTACGTGCCAGG + Intronic
1121627804 14:95399440-95399462 CTGGGCAAAGATTTCAGGCCTGG - Intergenic
1121746873 14:96303160-96303182 CTGAACAATGAACACCTGCCGGG + Exonic
1124227900 15:27911550-27911572 GTGTGCAGAGATCACATGGCAGG + Intronic
1124956655 15:34364747-34364769 CAGGGCAAAGATAACAGGCCAGG - Intronic
1125306787 15:38326446-38326468 CTAAGCAAAGATCAAATCCAGGG + Intronic
1126116445 15:45211984-45212006 CTGAGCAAAGATCAAATCTAGGG + Intergenic
1127054593 15:55118535-55118557 CAGAGCATAAATCACAGGCCAGG + Intergenic
1128976667 15:72159339-72159361 TTGAGCCAAGACTACATGCCAGG - Intergenic
1129329577 15:74820200-74820222 CTGAGCAGAGCTCAGAGGCCAGG - Intronic
1129893417 15:79086956-79086978 CTGAGCAAAGGGCCCAGGCCAGG + Intronic
1131602511 15:93863719-93863741 CTGTGCAGAGATCACATGGTGGG - Intergenic
1131856561 15:96603305-96603327 CTGAGCAAGCAGCACATGCAAGG + Intergenic
1131917602 15:97287177-97287199 CTGAGAAATGATCACAACCCAGG + Intergenic
1133099232 16:3469269-3469291 CAGAGCAGAGAGCACCTGCCTGG + Intronic
1133099251 16:3469364-3469386 CAGAGCAGAGAGCACCTGCCTGG + Intronic
1133099272 16:3469459-3469481 CAGAGCAGAGAGCACCTGCCTGG + Intronic
1133099290 16:3469554-3469576 CAGAGCAGAGAGCACCTGCCTGG + Intronic
1133099308 16:3469649-3469671 CAGAGCAGAGAGCACCTGCCTGG + Intronic
1133365250 16:5203884-5203906 CTGAGCCAAGATCACACCACTGG - Intergenic
1135613536 16:23889260-23889282 CTGAACCAAGATCACATGCTTGG - Intronic
1135860347 16:26050524-26050546 TTGAGCACATTTCACATGCCAGG + Intronic
1135867613 16:26118730-26118752 ATGAGGAAATATCAAATGCCAGG + Intronic
1136449619 16:30346391-30346413 CTCAGCTGAGATTACATGCCTGG + Intergenic
1136590188 16:31213980-31214002 CTGGGCACACATCACATGACAGG - Intergenic
1137069973 16:35895834-35895856 CTGTGCAGAGATCACATGGCAGG - Intergenic
1137269567 16:46894421-46894443 CTGAGCAAGGACCCCATGCCAGG + Intronic
1137330092 16:47485673-47485695 GTGAGCAAAGATCACGCACCTGG - Intronic
1139233626 16:65311418-65311440 GTGAGTGAAGATGACATGCCTGG + Intergenic
1139281708 16:65776219-65776241 TTGAGCAAGGACAACATGCCAGG + Intergenic
1141436691 16:84003774-84003796 CAGAGCCAAGACCACAGGCCAGG + Intergenic
1143390014 17:6554935-6554957 TTGAGCACAGGTCACCTGCCAGG - Intronic
1144265219 17:13562235-13562257 CTGAGCTTCCATCACATGCCAGG + Intronic
1144492262 17:15723384-15723406 ATGAGCAAAGATTCCCTGCCAGG - Intergenic
1144782043 17:17813326-17813348 CTGAGCAGACAGCACATCCCTGG + Intronic
1144998950 17:19290128-19290150 CTGAGCACTGACTACATGCCAGG - Intronic
1146111765 17:30096130-30096152 CTGGGTAAAGATCTCAGGCCTGG + Intronic
1147883824 17:43670993-43671015 CTGGGCAAAGAACACATAACAGG - Intergenic
1148825763 17:50392745-50392767 CTGAGCAAAGCTGACAGGCAAGG + Exonic
1150469092 17:65420921-65420943 CTGATCACTTATCACATGCCAGG - Intergenic
1151144432 17:72027657-72027679 CTGGGGATAGATCACATTCCTGG + Intergenic
1151471697 17:74322382-74322404 CTGAGCATACATCAAGTGCCTGG + Intergenic
1151492772 17:74442745-74442767 CAGATCAAAGATCAAGTGCCCGG - Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152326132 17:79638793-79638815 TTGTGCAGAGATCACATGGCAGG - Intergenic
1203159806 17_GL000205v2_random:38814-38836 CTGAGCACAGGGCACAGGCCGGG + Intergenic
1155255333 18:23992330-23992352 GTGAGCAAAGACCACATGTCTGG - Intergenic
1156550612 18:38012423-38012445 CTGAGCAAAGGCCACATGGACGG + Intergenic
1157443266 18:47726106-47726128 CTGAGCACCTATCACATTCCAGG - Intergenic
1157924725 18:51751099-51751121 CTGAGTAGAGATCAAGTGCCTGG + Intergenic
1158839136 18:61364687-61364709 ATGCGCAGAGATCACATGGCAGG - Intronic
1161603984 19:5204365-5204387 CTGAGCCAGAATCACATCCCTGG - Intronic
1162501072 19:11054266-11054288 CTGAGCACAGCCCAGATGCCCGG + Intronic
1165093978 19:33400757-33400779 CTGGGCAAAGGTGACAAGCCAGG + Intronic
1165698482 19:37919273-37919295 CTGAGCATCTCTCACATGCCAGG - Intronic
1165717320 19:38054825-38054847 CTGAGCAGCGACCACAGGCCAGG - Intronic
925062209 2:901662-901684 CTGTCCAAACATCACATGCCTGG - Intergenic
925071816 2:975199-975221 CTGAGCAAACACCACACGCTTGG + Intronic
925071827 2:975331-975353 ATGAGCAAACACCACATGCTTGG + Intronic
925258385 2:2508772-2508794 CTGAGCATTTATCACGTGCCAGG - Intergenic
926031812 2:9597589-9597611 GTGAGACAAGATCACCTGCCTGG + Intronic
929077656 2:38091845-38091867 CTGAGCACCCACCACATGCCAGG - Intronic
929250088 2:39743676-39743698 GTGTGCAGAGATCACATGGCAGG - Intronic
932694317 2:73941962-73941984 CTGAGCCAAGATCACACCACTGG - Intronic
932959302 2:76394091-76394113 CTGAGGAAAGAATACATTCCAGG + Intergenic
937158211 2:119736472-119736494 CTTAGGAAACATCACATGCAAGG + Intergenic
937242424 2:120470889-120470911 CTGATCCAAGTTCACATGGCTGG - Intergenic
937809669 2:126185480-126185502 GTGAGCCAAGATCACACCCCTGG + Intergenic
938711461 2:133979230-133979252 CTGAGCAAATAGCACAGGACTGG + Intergenic
940740923 2:157506724-157506746 CTGAGCAGAGATCAAATCCAGGG - Intergenic
941063013 2:160869230-160869252 CTGGGAAAGGAACACATGCCTGG - Intergenic
943687251 2:190831505-190831527 TTGAGTAAAGAACACATGTCAGG + Intergenic
945936082 2:215904130-215904152 CAGAGCAAAGACCTCAAGCCAGG + Intergenic
946012184 2:216574153-216574175 CTGAGCCATGTTGACATGCCTGG - Intronic
946724761 2:222651432-222651454 CTGAGCAAAGACCAAATCCAAGG + Intronic
946744330 2:222830734-222830756 GTGAGCAAAGATCTCCAGCCTGG - Intergenic
1169040704 20:2493019-2493041 CTGAGCACAGAACACATTCTAGG + Intronic
1169171608 20:3470253-3470275 CTGAGCACAGCCTACATGCCAGG + Intergenic
1169720579 20:8671966-8671988 CTGAGCATTGACCACATGCCAGG - Intronic
1173547140 20:43906592-43906614 CTGAGCAAGGGTGACCTGCCCGG - Intergenic
1174854160 20:54027015-54027037 CTCAGTAAAGAGCAGATGCCTGG + Intronic
1174859762 20:54079760-54079782 TTGAGCAACTATCACTTGCCAGG + Intergenic
1175329529 20:58153784-58153806 CTGGGCACTGACCACATGCCAGG + Intronic
1175661948 20:60821135-60821157 CTGAGCAAAGCCCCCGTGCCAGG + Intergenic
1175919916 20:62446057-62446079 CTGAGCAAATGGCACATGCTGGG - Intergenic
1178383623 21:32132213-32132235 CAGAGCAAAAATCACAAGACAGG + Intergenic
1178740571 21:35196464-35196486 CTTAGCAGAGATCACATTCCAGG + Intronic
1180607269 22:17068188-17068210 CTGAGCACCGACCAAATGCCAGG - Intergenic
1180612336 22:17106127-17106149 CTGTGCAAATAGCACATGCCAGG - Intronic
1181869155 22:25884303-25884325 CTGAGCCCAGACCACATCCCAGG + Intronic
1182032075 22:27167297-27167319 CTCAGCACAGGACACATGCCTGG + Intergenic
1183642151 22:39099393-39099415 CTGAGCAAAGAGCACAGTGCTGG + Intronic
1183758542 22:39793901-39793923 CTGAGCAAAGAAAACAAACCAGG - Intronic
1184742481 22:46437150-46437172 CTGAGCAAAAACCACCTGCTCGG + Intronic
1185117913 22:48948684-48948706 CTCAGCACAGATCCCAAGCCTGG + Intergenic
950049886 3:9979903-9979925 CTGAGAAAAGGCCACATGACTGG + Intronic
950760442 3:15219201-15219223 CTGAGCACATATTACATGTCAGG - Intronic
952703286 3:36349025-36349047 CTGAACACAGATCACATCACAGG + Intergenic
954622714 3:52005118-52005140 CTGAGCAATGTCCACAGGCCAGG - Intergenic
956160345 3:66345188-66345210 CTGAGCACTGATCACGTCCCAGG - Intronic
956350121 3:68325474-68325496 CTGAGCATTTATCTCATGCCAGG - Intronic
956379536 3:68651157-68651179 CTGAGCACTTACCACATGCCAGG + Intergenic
956576924 3:70761943-70761965 TTGAGCAAAGATCATAATCCTGG + Intergenic
957579383 3:82051203-82051225 CAGAGACAAGATCACATGGCTGG - Intergenic
958108065 3:89103699-89103721 GTGAGCCAAGATCACATCACTGG - Intergenic
958497475 3:94863605-94863627 CTGAGAAAAGAATGCATGCCCGG - Intergenic
959991894 3:112639573-112639595 CTGAGCAAAGACCAGCAGCCAGG - Exonic
962734412 3:138312318-138312340 CTGAGCAAAAATAACAAACCTGG + Intronic
964423297 3:156527766-156527788 CAGATCAAAGATAACGTGCCTGG - Intronic
965942923 3:174207248-174207270 TTGAGTAAAGATAACATGCTTGG + Intronic
967422783 3:189292557-189292579 TTGAGCACCTATCACATGCCAGG - Intronic
967592122 3:191290365-191290387 TTGAGCAATCATCACATGCCAGG + Intronic
967710440 3:192701062-192701084 CTGATAAAAGCTCAGATGCCTGG + Intronic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968807407 4:2784317-2784339 CTGAAGACAGATCACATCCCAGG - Intergenic
969512696 4:7628593-7628615 CTGAGCACCGACTACATGCCAGG + Intronic
975994015 4:80293156-80293178 CTGAGCAACTAACATATGCCAGG - Intronic
977244099 4:94609381-94609403 TTTAGAAAAGATCAAATGCCTGG - Intronic
978038837 4:104032626-104032648 TTTAGCAAAAATCACATTCCTGG + Intergenic
978861831 4:113459680-113459702 GTGAGCCAAGATCGCAAGCCTGG - Intronic
980770637 4:137368049-137368071 CTGAGCAAATATCAAATCCAGGG - Intergenic
983190000 4:164745250-164745272 CTGAGCAAAGATCAAATCTAGGG - Intergenic
984531462 4:180921706-180921728 CTGAGAAAATATCAGATGACTGG - Intergenic
985067898 4:186141702-186141724 CTGTGCAAAGATCAAATCCTAGG + Intronic
988319556 5:29675653-29675675 CTGGGCAATGATCACATGAAAGG - Intergenic
988726619 5:33932893-33932915 ATGAGCTGAGATCACATGGCTGG - Intergenic
989420204 5:41229590-41229612 CTGAGAATAGATCACATGTTAGG - Intronic
990271820 5:54150171-54150193 CTGAGCATGTATTACATGCCAGG - Intronic
992072156 5:73158161-73158183 GTGTGCAGAGATCACATGGCAGG + Intergenic
993828788 5:92727361-92727383 ATGAGCCAAGATCACATCACTGG + Intergenic
994762321 5:103870641-103870663 CTGTGCAAAAAACAGATGCCAGG - Intergenic
995205095 5:109470507-109470529 CTGTGCAGAGATCACATGGCTGG - Intergenic
995647617 5:114330262-114330284 CTGAGGACAGATCTCATCCCAGG - Intergenic
998465937 5:142343920-142343942 GTGAGCCAAGATCACACACCTGG - Intergenic
1000767641 5:165311314-165311336 CTTTCCTAAGATCACATGCCTGG - Intergenic
1001905760 5:175471773-175471795 CTGAGCTGAGGTCACATGCCAGG - Intergenic
1003816480 6:9846970-9846992 CTGAGCAAAGATCACATGCCAGG - Intronic
1009457135 6:63870963-63870985 CTGAGCAGAGATCACAGGACTGG - Intronic
1010365407 6:75045024-75045046 TTGAGGATAGATCACATGCTAGG + Intergenic
1011225256 6:85097681-85097703 CTGAGGACAGATCACATCACAGG + Intergenic
1011446802 6:87450257-87450279 CTGAGCAAAGAGAACAAACCTGG - Intronic
1011787407 6:90862435-90862457 CTTAGCAAAGCTCACAGGACAGG - Intergenic
1012162988 6:95910982-95911004 CTTAACAAAGATTGCATGCCAGG + Intergenic
1015184072 6:130393537-130393559 CTGAGCAAAGATCATGTTCATGG + Intronic
1016497039 6:144675294-144675316 CTGAGGACAGATCACATTACAGG - Intronic
1016876426 6:148870236-148870258 CTGAGCCCAGGTCACATGGCTGG - Intronic
1019602220 7:1890412-1890434 TTGGGCAGAGATCACATGGCAGG - Intronic
1021695315 7:23270581-23270603 CTGAGCAAAGATATGAAGCCTGG + Intronic
1021926846 7:25542131-25542153 CTGAGTAAAGAACACATTCTTGG - Intergenic
1022171455 7:27836032-27836054 CTTGGCCAAGATCACATGGCTGG + Intronic
1022245299 7:28553375-28553397 CTAATGAAAGATTACATGCCAGG - Intronic
1022665087 7:32403239-32403261 GTGAGGAAAGATCACTAGCCAGG + Intergenic
1023178994 7:37462301-37462323 CTGTGTAAAGATCACAAACCAGG + Intergenic
1023440141 7:40176915-40176937 GTGAGCCAAGATCGCAAGCCTGG + Intronic
1025078183 7:55961749-55961771 CTGAGCTGAGATCACCTCCCAGG + Intronic
1026466547 7:70659501-70659523 CTGAGCTCAGTTAACATGCCCGG - Intronic
1026579999 7:71607659-71607681 ATGAGAAAAGATGACCTGCCAGG + Intronic
1027263253 7:76479727-76479749 GTGAGCCGAGATCACACGCCTGG + Intronic
1027314635 7:76977832-76977854 GTGAGCCGAGATCACACGCCTGG + Intergenic
1027878194 7:83798797-83798819 GTGAGCAAAAATCACTTGCAAGG - Intergenic
1028164997 7:87528613-87528635 CAGAGCACAGATCACAGGCAGGG + Intronic
1030812608 7:113992778-113992800 CTGAGCAAAAATCACAAAACTGG + Intronic
1031737350 7:125383138-125383160 CTGAGTAAATACCACATGCCAGG - Intergenic
1031749497 7:125554565-125554587 CTGTGCACAGATCTCATGTCTGG - Intergenic
1033299349 7:140173283-140173305 GTGAGAAAAGAACACTTGCCAGG - Intronic
1033925844 7:146459335-146459357 CTGAGCTAATATCACATGACTGG - Intronic
1033999306 7:147391816-147391838 CTAAGCAAAGATCAAATTCCAGG - Intronic
1035526616 8:317887-317909 CTGAGCACAAACTACATGCCAGG + Intergenic
1036974491 8:13395790-13395812 CTGAGCAAATTTCTGATGCCTGG + Intronic
1037078202 8:14748783-14748805 CTGAGCAATTATCATGTGCCTGG + Intronic
1037534339 8:19810862-19810884 CTGAGCAAACCCCACATGGCTGG - Intergenic
1037636721 8:20706679-20706701 CTGAGCAAAGCTCATCTTCCAGG - Intergenic
1037681900 8:21104561-21104583 CTAAGAAAAGATTACATTCCAGG + Intergenic
1037995133 8:23346741-23346763 CTGAGCTAAGACAACGTGCCTGG - Intronic
1038217542 8:25576662-25576684 CTGAGATAAGCTCACAAGCCAGG - Intergenic
1038269528 8:26064072-26064094 CTAAACAAAGATCACATCCTGGG - Intergenic
1039377063 8:37045191-37045213 ATGTGCAGAGATCACATGACAGG + Intergenic
1040524842 8:48212297-48212319 CTGAACACAGATCACATCACAGG + Intergenic
1040904897 8:52457817-52457839 CTGTGCAGAGATCACATGAAGGG - Intronic
1041617906 8:59929715-59929737 CTGAGCAAAGAACAAATGCTAGG + Intergenic
1042405194 8:68396776-68396798 CTGTGCAGAGATCACATGGCAGG - Intronic
1042719444 8:71811353-71811375 CTGAGCAACGACCACGTGCCTGG - Intergenic
1044669011 8:94659750-94659772 CTGAGCAAAGATGAGAAGGCTGG + Intronic
1045243123 8:100419627-100419649 TGGAGCCCAGATCACATGCCAGG - Intergenic
1045636267 8:104194840-104194862 AGGAGCAAAGAGGACATGCCAGG + Intronic
1045987987 8:108272301-108272323 TTGAGCAATGATCACATTGCTGG - Intronic
1046748338 8:117899984-117900006 CTGAGCTCCCATCACATGCCAGG + Intronic
1047839518 8:128735426-128735448 CTGAGCTAAGTTTATATGCCAGG - Intergenic
1048475010 8:134734985-134735007 CTGAGCACAGAACAAATGGCAGG - Intergenic
1049455955 8:142687864-142687886 CAGAGCATTCATCACATGCCTGG + Intergenic
1050159480 9:2702489-2702511 CAGAGCAAGTACCACATGCCGGG + Intergenic
1051046895 9:12886639-12886661 ATGTGCAGAGATCACATGGCAGG + Intergenic
1055072350 9:72179780-72179802 ATGAGCAAAGAAGACAGGCCTGG - Intronic
1056799333 9:89680716-89680738 CTGAGCACAGATCATGTGCATGG - Intergenic
1058728853 9:107830207-107830229 CTGAGCAAAGAGAACAAACCTGG - Intergenic
1059010720 9:110456077-110456099 CAGATCACAGCTCACATGCCAGG + Intronic
1059086821 9:111312141-111312163 CTGAGCAAAAAGAACATGGCTGG - Intergenic
1059139338 9:111837431-111837453 CTGAGCACTCATAACATGCCAGG + Intergenic
1059415204 9:114157915-114157937 CTGAGCACTTATTACATGCCAGG - Intronic
1060412088 9:123406516-123406538 CTGAGCAACCATGACATACCAGG - Intronic
1060594445 9:124839941-124839963 CTGAGCAAACATCAGTTCCCTGG + Intergenic
1060895130 9:127212309-127212331 CTCAGCAAAAGTCACATGCATGG + Intronic
1061173515 9:128976977-128976999 CTGAGGTAGGATCACTTGCCTGG + Intronic
1187089409 X:16079463-16079485 CTGAGCAATTATCATGTGCCAGG - Intergenic
1187752136 X:22478528-22478550 CTGAACACAGATCACATGACAGG - Intergenic
1188475729 X:30589646-30589668 GTGTGCAGAGATCACATGGCAGG + Intergenic
1189100597 X:38185459-38185481 CTGAACAAAGATCAAATCCAAGG + Intronic
1189278636 X:39805349-39805371 CTGAGGAATGATGACATGACAGG + Intergenic
1190984011 X:55484373-55484395 CAGAGAAAAGAGCACAGGCCTGG - Intergenic
1191039548 X:56064929-56064951 CTCAGCAAACCTTACATGCCAGG - Intergenic
1194242422 X:91468624-91468646 CTGAGCAAAAAGCACAAACCTGG - Intergenic
1194458727 X:94138633-94138655 CTGAAGAAAAATCTCATGCCAGG + Intergenic
1194496676 X:94624438-94624460 CTGAGCCAATATTACATACCAGG - Intergenic
1194595343 X:95849915-95849937 CTGTGCAAACATTACAGGCCAGG + Intergenic
1194897962 X:99469010-99469032 CTGTGCAAAGATCATAAACCAGG + Intergenic
1195967601 X:110442896-110442918 CTGGGCAAAGTTCTCATCCCAGG - Intronic
1197702324 X:129608615-129608637 CTGAGGAAAGCGCACATGGCTGG + Intergenic
1198232538 X:134705360-134705382 GTGAGCCAAGATCACATCACTGG + Intronic
1198682370 X:139196507-139196529 CTGAACAAAGACCACAGCCCTGG + Intronic
1198990736 X:142511913-142511935 CTGAACTAAGATCAGATGACAGG - Intergenic
1199746934 X:150777726-150777748 CTGAGCATGCCTCACATGCCGGG + Intronic
1199854951 X:151752448-151752470 CTGGGCAAATATCACGTTCCAGG - Intergenic
1200891746 Y:8331426-8331448 CTGTGCACAGTTCACAGGCCTGG + Intergenic
1201720324 Y:17089708-17089730 CAGGGCAATGATGACATGCCGGG + Intergenic