ID: 1003816851

View in Genome Browser
Species Human (GRCh38)
Location 6:9851280-9851302
Sequence GCCTGTCTGGTCATTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003816839_1003816851 30 Left 1003816839 6:9851227-9851249 CCTAGGTGCATCTGAACTGCATG 0: 1
1: 0
2: 2
3: 14
4: 132
Right 1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG No data
1003816844_1003816851 4 Left 1003816844 6:9851253-9851275 CCATGCCTGCCAGGCCCTCACCA 0: 1
1: 0
2: 8
3: 59
4: 576
Right 1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG No data
1003816846_1003816851 -5 Left 1003816846 6:9851262-9851284 CCAGGCCCTCACCAGACTGCCTG 0: 1
1: 0
2: 2
3: 52
4: 417
Right 1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG No data
1003816843_1003816851 5 Left 1003816843 6:9851252-9851274 CCCATGCCTGCCAGGCCCTCACC 0: 1
1: 0
2: 4
3: 41
4: 428
Right 1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG No data
1003816841_1003816851 7 Left 1003816841 6:9851250-9851272 CCCCCATGCCTGCCAGGCCCTCA 0: 1
1: 1
2: 7
3: 54
4: 573
Right 1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG No data
1003816842_1003816851 6 Left 1003816842 6:9851251-9851273 CCCCATGCCTGCCAGGCCCTCAC 0: 2
1: 0
2: 2
3: 58
4: 495
Right 1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG No data
1003816845_1003816851 -1 Left 1003816845 6:9851258-9851280 CCTGCCAGGCCCTCACCAGACTG 0: 1
1: 0
2: 2
3: 39
4: 359
Right 1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG No data
1003816847_1003816851 -10 Left 1003816847 6:9851267-9851289 CCCTCACCAGACTGCCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 261
Right 1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003816851 Original CRISPR GCCTGTCTGGTCATTCCCAG AGG Intronic
No off target data available for this crispr