ID: 1003819085

View in Genome Browser
Species Human (GRCh38)
Location 6:9876007-9876029
Sequence TACGACTGCATTGGAGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003819085_1003819093 9 Left 1003819085 6:9876007-9876029 CCCTAACCTCCAATGCAGTCGTA 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1003819093 6:9876039-9876061 GAGGCCTTTGGGAGATAATTAGG 0: 14
1: 123
2: 514
3: 1503
4: 2646
1003819085_1003819092 -2 Left 1003819085 6:9876007-9876029 CCCTAACCTCCAATGCAGTCGTA 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1003819092 6:9876028-9876050 TATGTGGAGATGAGGCCTTTGGG 0: 2
1: 29
2: 217
3: 769
4: 2095
1003819085_1003819090 -10 Left 1003819085 6:9876007-9876029 CCCTAACCTCCAATGCAGTCGTA 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1003819090 6:9876020-9876042 TGCAGTCGTATGTGGAGATGAGG 0: 1
1: 0
2: 3
3: 20
4: 200
1003819085_1003819096 29 Left 1003819085 6:9876007-9876029 CCCTAACCTCCAATGCAGTCGTA 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1003819096 6:9876059-9876081 AGGTTTAGATGAGATCATGAGGG 0: 17
1: 128
2: 306
3: 545
4: 1144
1003819085_1003819095 28 Left 1003819085 6:9876007-9876029 CCCTAACCTCCAATGCAGTCGTA 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1003819095 6:9876058-9876080 TAGGTTTAGATGAGATCATGAGG 0: 13
1: 121
2: 334
3: 538
4: 923
1003819085_1003819091 -3 Left 1003819085 6:9876007-9876029 CCCTAACCTCCAATGCAGTCGTA 0: 1
1: 1
2: 1
3: 13
4: 138
Right 1003819091 6:9876027-9876049 GTATGTGGAGATGAGGCCTTTGG 0: 2
1: 25
2: 213
3: 691
4: 1813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003819085 Original CRISPR TACGACTGCATTGGAGGTTA GGG (reversed) Intronic
900893051 1:5463514-5463536 TACCATTGCATTGGAGATTGAGG - Intergenic
903127567 1:21258261-21258283 CACTTCTGCATTGGAGGTTGGGG + Intronic
906430646 1:45753319-45753341 TACCATTACATTGGAGGCTAGGG - Intergenic
907523126 1:55038115-55038137 TAAGAGTGCAGTGGAGGATATGG + Intergenic
908245424 1:62224127-62224149 TACCATCACATTGGAGGTTAGGG - Intergenic
911233678 1:95386582-95386604 TACGGTGGCATTGGGGGTTAAGG + Intergenic
920040804 1:203094761-203094783 TACTATTACATTGGGGGTTAGGG + Intronic
920975589 1:210782350-210782372 TACCACTGTATTGGGAGTTAGGG - Intronic
923738415 1:236633730-236633752 TACCATCACATTGGAGGTTAAGG + Intergenic
1063347956 10:5328642-5328664 TACGGTCACATTGGAGGTTAGGG - Intergenic
1063908827 10:10809022-10809044 TACCACCACATTGGGGGTTAGGG - Intergenic
1068605170 10:58997376-58997398 GACGACTGGATAGGAGTTTAAGG + Intergenic
1068639602 10:59388439-59388461 TACAGCTACATTGGAGATTAAGG + Intergenic
1070365907 10:75736959-75736981 CACGGCTGATTTGGAGGTTAGGG + Intronic
1070519384 10:77238578-77238600 TTTGAATGCATTGCAGGTTAAGG + Intronic
1070604154 10:77886738-77886760 TATGACTGTATTGGAAGATAAGG + Intronic
1070688886 10:78510235-78510257 TACTATTGCACTGGAGATTAGGG + Intergenic
1072200527 10:93153943-93153965 TACCATTGCATTGAGGGTTAGGG + Intergenic
1080908007 11:36566234-36566256 TAACTCTGCTTTGGAGGTTATGG + Intronic
1081342065 11:41940842-41940864 TATGACTGCCTTGGAGATTTGGG - Intergenic
1081737354 11:45413261-45413283 TAGGACTGCTATGGCGGTTAAGG + Intergenic
1087046521 11:93848059-93848081 TACCATCACATTGGAGGTTAGGG + Intronic
1087466144 11:98509150-98509172 TATAACCACATTGGAGGTTAGGG - Intergenic
1088647040 11:111925890-111925912 TGCCCCTGCATTGGAGGTGAGGG + Intronic
1089640914 11:119846671-119846693 TACCATCACATTGGAGGTTAGGG + Intergenic
1093146664 12:15574987-15575009 TACCATTGCATTGGGGGTTAGGG - Intronic
1093232822 12:16568415-16568437 TATGAGTGGATTGGAGGTTGGGG - Intronic
1093933721 12:24979345-24979367 TACAGTTGCATTGGTGGTTAGGG - Intergenic
1094500530 12:31017100-31017122 TACCATTACATTGGTGGTTAGGG - Intergenic
1098301988 12:69063942-69063964 TACCATTGTATTGGCGGTTATGG - Intergenic
1098721859 12:73910329-73910351 TACCATCACATTGGAGGTTAAGG - Intergenic
1101530962 12:105573373-105573395 TACCAATGCATTGGAGGTTAGGG + Intergenic
1104411776 12:128564240-128564262 TACAATTGCATTGGGGGTTAGGG + Intronic
1104425421 12:128673160-128673182 TACCATTGCATTGGGTGTTAAGG - Intronic
1107284750 13:38778513-38778535 TACCACTGCCTTGGGGATTAGGG + Intronic
1108176865 13:47801261-47801283 TCCAACTACATTGGAGGATATGG - Intergenic
1110599534 13:77356658-77356680 TATCATGGCATTGGAGGTTAGGG - Intergenic
1114322704 14:21560342-21560364 TACAATCACATTGGAGGTTAGGG - Intergenic
1125339050 15:38656713-38656735 TACGGCAGCATTGGGAGTTAGGG - Intergenic
1126754820 15:51915902-51915924 TACCATCACATTGGAGGTTAGGG - Intronic
1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG + Intronic
1131964643 15:97828870-97828892 TAGGACTGCCTTGGATGTTCAGG - Intergenic
1132025232 15:98399510-98399532 TACCATTACATTGGGGGTTAAGG - Intergenic
1133593279 16:7266592-7266614 TACCATCGCGTTGGAGGTTAGGG + Intronic
1134130338 16:11645119-11645141 GACCACTGCATTGTAGGATAAGG - Intergenic
1139891537 16:70256086-70256108 TAAGACTGTATTGGATATTAGGG - Intronic
1140188620 16:72795969-72795991 TACTCCTGCTTTGGAGGTTCCGG + Exonic
1140912582 16:79467570-79467592 AACCACTGACTTGGAGGTTAAGG - Intergenic
1143395200 17:6589139-6589161 TACTACCACATTGGGGGTTAGGG - Intronic
1143919709 17:10321159-10321181 TACAACAGGATTGGAGGTTTTGG + Intronic
1144243763 17:13341284-13341306 TACCATCACATTGGAGGTTAGGG + Intergenic
1148263467 17:46205086-46205108 TAACACTGCACTGAAGGTTATGG + Intronic
1151387808 17:73765839-73765861 TACCATTGCATTCGAGGTTAGGG + Intergenic
1151941639 17:77295946-77295968 TACAGCTGCATTGGGAGTTAGGG - Intronic
1155815306 18:30300424-30300446 TTCGAGAGCATTGAAGGTTAAGG - Intergenic
1160485837 18:79291452-79291474 TACTACTGCATAAGAGGTGAAGG + Intronic
1165276521 19:34757251-34757273 AAGGAGTGCATTGGAGGTTAGGG - Intergenic
1166993619 19:46708203-46708225 TATAGTTGCATTGGAGGTTAGGG - Intronic
925715339 2:6779730-6779752 TACCACGACATTGGGGGTTAGGG + Intergenic
926130144 2:10297891-10297913 TACAATTACATTAGAGGTTAGGG + Intergenic
928063692 2:28141120-28141142 TACTATTGCATTGGGGGTTAGGG + Intronic
935337439 2:102029795-102029817 TACCATTGTATTGGAGGTTAGGG + Intergenic
935448695 2:103185597-103185619 TACAGCTGCATTGGGGGTTAGGG - Intergenic
936159823 2:110076455-110076477 TACAGTTGCATTGGGGGTTAGGG + Intergenic
936184842 2:110294898-110294920 TACAGTTGCATTGGGGGTTAGGG - Intergenic
938156930 2:128949583-128949605 TATGACTGCATTGTGGGTTTGGG - Intergenic
940024319 2:149189201-149189223 CACGACTACATTTGAGGTTCTGG - Intronic
943926617 2:193791639-193791661 TGCCACTGCATTGGAGCTTGTGG - Intergenic
945922419 2:215769164-215769186 AACAACTGCATTGGATGTGAGGG + Intergenic
946929665 2:224659359-224659381 TACCATTACATTGGAGATTAGGG - Intergenic
947999721 2:234557721-234557743 TATCATTACATTGGAGGTTAGGG + Intergenic
1168906195 20:1405628-1405650 TACCAGTACCTTGGAGGTTAGGG + Intergenic
1171314503 20:24177232-24177254 CACCATTACATTGGAGGTTAGGG + Intergenic
1172919223 20:38467538-38467560 TACCATCACATTGGAGGTTAGGG - Intergenic
1173612773 20:44382705-44382727 TACGACTGGGTTAGAGGTTTGGG + Intronic
1174734193 20:52949311-52949333 TTCAAGTGCATTAGAGGTTAAGG + Intergenic
1175250059 20:57603829-57603851 TACCACTGCACTGGGGATTATGG + Exonic
1181872402 22:25910444-25910466 TACCACTGCACTGAGGGTTAGGG + Intronic
1182768384 22:32775323-32775345 TACAGCTGCACTGGAGGTTGAGG + Intronic
1183356757 22:37363901-37363923 TAGGTGTGCATTGGAGGTGACGG - Intergenic
1185005106 22:48271207-48271229 TACCATTACATTGGACGTTAGGG + Intergenic
949678315 3:6483433-6483455 TACTACTGCTTTGGAACTTAAGG + Intergenic
956057491 3:65315634-65315656 TACTACTGCATTGGGGATTAAGG + Intergenic
957839153 3:85643913-85643935 TACAGCTACATTGGGGGTTAGGG + Intronic
957866802 3:86036078-86036100 TACCATTGCTTTGGATGTTAGGG + Intronic
958950629 3:100411833-100411855 TACCATCGCATTGGGGGTTAGGG + Intronic
962712100 3:138096701-138096723 TAGTTCTGCATTGGAGGCTAAGG - Intronic
963886200 3:150585734-150585756 TACCACCACGTTGGAGGTTAGGG - Intronic
964623604 3:158738691-158738713 TACCATCACATTGGAGGTTAGGG + Intronic
965166366 3:165197492-165197514 TATGACTGCAGTGGGGGTAATGG - Intergenic
966397011 3:179514533-179514555 TACGGGTACATTGGAGATTAGGG - Intergenic
966643380 3:182215469-182215491 TACCATTGCATTGGGAGTTAGGG + Intergenic
970836939 4:20420723-20420745 TACCACTGCATTGGAGGTTAGGG - Intronic
971447578 4:26767451-26767473 TACCATCACATTGGAGGTTAGGG - Intergenic
971451125 4:26803063-26803085 TACCATCACATTGGAGGTTAGGG + Intergenic
972406279 4:38749691-38749713 TATCACTGCATTGGAGCTTGAGG - Intergenic
974246775 4:59330380-59330402 TACAACAGCATTGGAAGGTAAGG + Intergenic
974270845 4:59650005-59650027 TATGATTACATTGGAAGTTAGGG + Intergenic
976182496 4:82411843-82411865 TACAACCACATTGGAGGTTAGGG + Intergenic
981402824 4:144334561-144334583 TACCATCACATTGGAGGTTATGG + Intergenic
982445589 4:155487025-155487047 TACCATTACATTGGGGGTTAGGG - Intergenic
984366791 4:178809528-178809550 TAGAACTGCCATGGAGGTTAAGG + Intergenic
986304556 5:6505762-6505784 TGCAACTGCATGGGAGGTTCTGG + Intergenic
986677163 5:10196152-10196174 TCCAAATGCACTGGAGGTTAGGG + Intergenic
988895926 5:35674754-35674776 TACCATCACATTGGAGGTTAGGG + Intronic
989118083 5:37976294-37976316 GAGGACAGCATTAGAGGTTAGGG - Intergenic
991194083 5:63911467-63911489 TACAGGTACATTGGAGGTTAGGG + Intergenic
991930944 5:71751836-71751858 TACGATCCCATTGGGGGTTAGGG + Intergenic
992164720 5:74038352-74038374 TACCACTACACTGGGGGTTAAGG - Intergenic
993697690 5:91081251-91081273 TACCATTGCATTGGGAGTTAGGG + Intronic
993937833 5:94025482-94025504 TACAATAGCATTGGAGGTTAAGG + Intronic
999961145 5:156756886-156756908 GACAGCTGCATTGAAGGTTAAGG + Intronic
1001252977 5:170162662-170162684 TACCATCACATTGGAGGTTAGGG - Intergenic
1003819085 6:9876007-9876029 TACGACTGCATTGGAGGTTAGGG - Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1008596243 6:53044676-53044698 TACAATCTCATTGGAGGTTAGGG - Intronic
1009421749 6:63471772-63471794 TACCATTGCACTGGGGGTTAGGG - Intergenic
1009895808 6:69747095-69747117 TACCATTACATTGGGGGTTAGGG - Intronic
1016310388 6:142727528-142727550 TACCATCCCATTGGAGGTTAGGG - Intergenic
1016917207 6:149255102-149255124 TACCATTACATTGGGGGTTAGGG - Intronic
1017434269 6:154401211-154401233 TACCATTGCTTTGGAGATTAGGG - Exonic
1018297188 6:162361292-162361314 TACGATCACATTGGGGGTTAGGG - Intronic
1020945452 7:14600304-14600326 TATGATTGCATTGGTGATTAAGG + Intronic
1020965854 7:14867344-14867366 TACTACTGCATTGGATATTTAGG + Intronic
1021414056 7:20361597-20361619 TACTATTGCATTAGAGGCTAAGG + Intronic
1021462173 7:20900844-20900866 TACCATTGCATTGGGGGCTAGGG + Intergenic
1021893899 7:25215155-25215177 TACAATCACATTGGAGGTTAGGG - Intergenic
1021950216 7:25766950-25766972 TATGGCTGCAATGGAGGTTGAGG + Intergenic
1022992578 7:35722971-35722993 TACAGCTACATTGGGGGTTAGGG + Intergenic
1023537878 7:41232460-41232482 CCCGACAGGATTGGAGGTTAGGG - Intergenic
1026145066 7:67739586-67739608 TGAGATTGCATTGGAGGTGAAGG + Intergenic
1029570750 7:101367263-101367285 TACCACCACATTGGAGGATAGGG - Intronic
1030364937 7:108635114-108635136 TAAGATCACATTGGAGGTTAGGG - Intergenic
1031006794 7:116482590-116482612 TACCATTACATTGGGGGTTAAGG + Intronic
1031714863 7:125096410-125096432 TACCAATACATTGGGGGTTAGGG + Intergenic
1032512017 7:132480023-132480045 TATGATTGAATGGGAGGTTAGGG - Intronic
1034319723 7:150168985-150169007 TCCCAATGCATTGAAGGTTAGGG - Intergenic
1034773030 7:153798234-153798256 TCCCAATGCATTGAAGGTTAGGG + Intergenic
1036643974 8:10600936-10600958 CACCACTGCCTTGGAGGTCAGGG - Intergenic
1039933342 8:42015554-42015576 TACGACTGTATAGGAGGTTGTGG - Intronic
1041600423 8:59711273-59711295 TACAACCACATTGGGGGTTAGGG - Intergenic
1048243656 8:132769535-132769557 TACCATTGCATTGGGGATTAGGG - Intergenic
1048763681 8:137824516-137824538 TACCATCACATTGGAGGTTAGGG - Intergenic
1052388267 9:27847956-27847978 TACGACTGCCTTGCTGGTTATGG + Intergenic
1054902870 9:70388179-70388201 AATGACTGCATTTGAAGTTAAGG + Intronic
1056217471 9:84418725-84418747 TACTATCACATTGGAGGTTAGGG - Intergenic
1186953249 X:14651857-14651879 TACCGTCGCATTGGAGGTTAGGG - Intronic
1189671482 X:43414929-43414951 TACCATGACATTGGAGGTTAGGG - Intergenic
1189740166 X:44109573-44109595 TACCATTACCTTGGAGGTTAGGG + Intergenic
1194752563 X:97701328-97701350 CACTACTGGATTGGAGGTCATGG - Intergenic
1195957626 X:110349455-110349477 TACTACCACATTGGAGATTAGGG + Intronic
1196074747 X:111563427-111563449 TACCATCACATTGGAGGTTAAGG - Intergenic
1199867849 X:151870248-151870270 TACGACTGTTTTGTAGGTCATGG + Intergenic
1200168255 X:154052343-154052365 AACCACTGCATGTGAGGTTAGGG + Intronic