ID: 1003820683

View in Genome Browser
Species Human (GRCh38)
Location 6:9893396-9893418
Sequence CGGGTGGGTTACCTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90810
Summary {0: 1, 1: 49, 2: 1708, 3: 20920, 4: 68132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003820676_1003820683 0 Left 1003820676 6:9893373-9893395 CCCAGCACTTTGGGAGGCCAAGA 0: 5583
1: 99313
2: 221046
3: 234614
4: 143836
Right 1003820683 6:9893396-9893418 CGGGTGGGTTACCTGAAGTCAGG 0: 1
1: 49
2: 1708
3: 20920
4: 68132
1003820674_1003820683 8 Left 1003820674 6:9893365-9893387 CCTGTGATCCCAGCACTTTGGGA 0: 2928
1: 292542
2: 261985
3: 151313
4: 136324
Right 1003820683 6:9893396-9893418 CGGGTGGGTTACCTGAAGTCAGG 0: 1
1: 49
2: 1708
3: 20920
4: 68132
1003820677_1003820683 -1 Left 1003820677 6:9893374-9893396 CCAGCACTTTGGGAGGCCAAGAC 0: 3058
1: 63262
2: 176853
3: 220638
4: 171177
Right 1003820683 6:9893396-9893418 CGGGTGGGTTACCTGAAGTCAGG 0: 1
1: 49
2: 1708
3: 20920
4: 68132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003820683 Original CRISPR CGGGTGGGTTACCTGAAGTC AGG Intronic
Too many off-targets to display for this crispr