ID: 1003822762

View in Genome Browser
Species Human (GRCh38)
Location 6:9918284-9918306
Sequence ATGGAGGAGCAGCATGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003822762_1003822768 6 Left 1003822762 6:9918284-9918306 CCCACCACATGCTGCTCCTCCAT 0: 1
1: 0
2: 0
3: 32
4: 315
Right 1003822768 6:9918313-9918335 CACAGGCTCCCTACAACTGATGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003822762 Original CRISPR ATGGAGGAGCAGCATGTGGT GGG (reversed) Intronic
900882332 1:5391062-5391084 ATGGAGGAGGGGTATGTGATGGG + Intergenic
900899201 1:5505374-5505396 AGGGAGGAACAGAATGTTGTTGG + Intergenic
901858922 1:12062237-12062259 ATGGATGAGCAGCAGGTGAGTGG - Intergenic
902903098 1:19533807-19533829 AAGGAGGAGCACCAAGTGCTGGG + Intergenic
902971324 1:20054067-20054089 ATGGAGGAGGACCAAGTGGAGGG - Intronic
903664095 1:24996159-24996181 AGGGAGGAGCAGCATGGAGGGGG - Intergenic
904599269 1:31664842-31664864 ATGGAGGAGTAGAATGTGATAGG - Intronic
905393199 1:37651154-37651176 ATTGTGGAGCAGCAGGTGGAAGG - Intergenic
906200382 1:43956465-43956487 AGGGTGGAGCAGCTTGGGGTGGG + Intronic
906676977 1:47700376-47700398 GTGCAGGAGCAGCAGGTGGGTGG + Intergenic
907475214 1:54700968-54700990 TTTGAGGAGCAGCAAGAGGTTGG + Intronic
907763078 1:57380877-57380899 ATTGAGGTGCTGCATGTGCTAGG - Intronic
908370973 1:63477075-63477097 CTGGAGGAGCAGCATGTCGAGGG + Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
910283980 1:85532666-85532688 ATGGTGGAGCAGCATATGAAGGG + Intronic
912214302 1:107590006-107590028 ATGAAGGATAAGCATGTTGTTGG + Intronic
912562225 1:110559226-110559248 ATGCAGGAGCAGCATTTCCTGGG - Intergenic
913196095 1:116457476-116457498 ATGAAGCAGCAGCAGGTGGCGGG - Intergenic
914206038 1:145530319-145530341 ATGGTGGAGCAGCATATGAAGGG - Intergenic
914730458 1:150364999-150365021 ACGGAGCCGCAGCATTTGGTTGG + Intronic
914747236 1:150509590-150509612 TTGGGGGAGCAGCATGGGATTGG + Intronic
915308125 1:154992865-154992887 GTGGAGGGCAAGCATGTGGTAGG - Intronic
915587876 1:156854128-156854150 ACGGAAGAGCAGCAGGTAGTCGG + Exonic
915682136 1:157591420-157591442 ATGTAGCATGAGCATGTGGTGGG + Intronic
916444638 1:164860972-164860994 ATAGAGGAGTAGCATGGTGTAGG + Intronic
916883607 1:169046152-169046174 ATGCAGAAGGACCATGTGGTGGG - Intergenic
921092963 1:211860372-211860394 GTGGGGGAGAAGCAAGTGGTAGG + Intergenic
922462979 1:225827186-225827208 ATGGAGGACATGCAAGTGGTGGG + Intronic
922719964 1:227895314-227895336 GCCGAGGAGCAGCATGGGGTCGG + Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
924722889 1:246639438-246639460 CTGGAGGAGCAGTGTGCGGTCGG + Intronic
924953886 1:248909202-248909224 ATGGAGGAGCCACATGTGAGGGG + Intronic
1063002941 10:1941643-1941665 ATGGAGAATCAGCATCTGATAGG + Intergenic
1063023462 10:2154148-2154170 ATGAATGGGCAGCAGGTGGTGGG + Intergenic
1063388564 10:5633028-5633050 ATGTGGGAGCCACATGTGGTGGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067114935 10:43427933-43427955 ATGCAGGAGCTGCATGTAATTGG + Intergenic
1068251769 10:54452248-54452270 ATGGAGGAGAAGCATTTTATAGG - Intronic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070678562 10:78433063-78433085 ATTGGGGAGCAGCATGGGCTGGG + Intergenic
1073419973 10:103416799-103416821 ATGAAGGAGCAGTAAGTAGTGGG + Intronic
1074771534 10:116738001-116738023 ATGAATGAGCAGCGTGTGGCAGG - Intronic
1075658677 10:124178314-124178336 GTTGAGGAGCTGCATTTGGTGGG + Intergenic
1076403457 10:130197673-130197695 GTGGGGGAGCATCATGTGGTGGG + Intergenic
1076810846 10:132885651-132885673 GTGGGGGAGCAGCAGGTGGTGGG + Intronic
1077506899 11:2933765-2933787 ATGGCCTAGCAGTATGTGGTTGG - Intergenic
1077784100 11:5363944-5363966 AAGGAGGAGAAGCTTGTGTTAGG + Intronic
1078537341 11:12185592-12185614 ATGGATGAGCAGACTGTGGCTGG + Intronic
1080278693 11:30531748-30531770 ATGGAAGAGCATTATGAGGTAGG - Intronic
1080612925 11:33920619-33920641 GAAGAGGAGCAGCATGAGGTTGG + Intergenic
1080757536 11:35216495-35216517 ATGGAGGAGCACTAGGAGGTAGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1084876733 11:72138906-72138928 ATGGAGGAGATGGCTGTGGTGGG + Intronic
1084960976 11:72716489-72716511 GTGGAGGAACAGCATCTGGACGG + Intronic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1087940106 11:104086314-104086336 CTGGAGGAACAGCATGTTTTAGG + Intronic
1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG + Intergenic
1090134669 11:124184937-124184959 CGGGAGGAGGAGCATGTGTTTGG + Intergenic
1090332338 11:125941853-125941875 TTGGAGCAGCAGCATGTGAAAGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1093315727 12:17647507-17647529 ATGGTGGAGCAGGAGGGGGTGGG - Intergenic
1095905012 12:47368723-47368745 ATGGAGGAACAGCAAGTGATTGG + Intergenic
1095950385 12:47778481-47778503 GTGGAGGAGGAGCATGGGGCAGG + Intronic
1096652437 12:53068470-53068492 ATGGAAGAGCAGGATGGGGTGGG + Intronic
1100246115 12:92758491-92758513 CTGGAGGAGCAGCTCCTGGTGGG + Intronic
1101204219 12:102469149-102469171 ATGTGGGAGCAGCCAGTGGTTGG - Intronic
1102361993 12:112296138-112296160 GTGTAGGTGCAGCAGGTGGTAGG + Intronic
1102457857 12:113082068-113082090 GTGGGGGAGCGGCATGTGGCTGG - Intronic
1102919717 12:116782783-116782805 CTGGAGGAGCTGCCTGTGATAGG - Intronic
1103721773 12:122979107-122979129 CTGGAGGTGGAGCACGTGGTGGG + Exonic
1103902481 12:124310566-124310588 GTTGAGGAGCAGGATGGGGTGGG + Intronic
1104005590 12:124890044-124890066 ATGGTGGAGCAGCAGGAGGTGGG - Intergenic
1106334052 13:28766429-28766451 ATTGTAGAGCAGCATGTGGATGG + Intergenic
1108473099 13:50787434-50787456 ATGGAACACCAGCATGTGTTGGG + Intronic
1109190991 13:59324081-59324103 ATGAAGGAACATCATGTTGTTGG - Intergenic
1110441557 13:75532143-75532165 ATTGAAGAGGAGCATCTGGTGGG + Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113338044 13:109395525-109395547 ATGGAGGTGGAGCCTGTGGGGGG + Intergenic
1113799770 13:113080329-113080351 AGGGAGGAGCAGCAAGTGCTCGG + Intronic
1114207957 14:20590816-20590838 ATGGGGGAGCAGCCAGGGGTTGG - Exonic
1115731167 14:36271453-36271475 AATGAAGAGCAGCATGTGGCAGG - Intergenic
1116587290 14:46723618-46723640 AATGAGGAGGGGCATGTGGTGGG + Intergenic
1117642014 14:57810131-57810153 ATGGAGGAGGGGCATGTGACAGG - Intronic
1117861670 14:60098236-60098258 ATGGGGGAGAAGCTTATGGTAGG - Intronic
1118040807 14:61914544-61914566 CTGGAGGAGGAACAGGTGGTAGG - Intergenic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1120541258 14:85753647-85753669 ATGGAGGAGCAAGTTGTGGTTGG + Intergenic
1120938486 14:89921642-89921664 ATGGAGGAGAACGATGGGGTAGG + Intronic
1121039280 14:90731667-90731689 GTGGAGGAGGAGCCTGTAGTGGG - Intronic
1121766788 14:96494720-96494742 ATGGGGGAGCAGCAGGTAGAGGG - Intergenic
1122033665 14:98932114-98932136 GTGGAGTTGCAGGATGTGGTTGG + Intergenic
1124058328 15:26263025-26263047 ATGGAGGGGCAGTGTCTGGTGGG + Intergenic
1124827501 15:33113508-33113530 ATGGAGGAGCAAACTGTTGTTGG - Intronic
1128549913 15:68591398-68591420 ATGGAGGGGCTGTATGTGGCTGG + Intronic
1128844811 15:70882857-70882879 ATGGATTATCAGCATGGGGTTGG + Exonic
1129888435 15:79055052-79055074 AGGGAGGAGAAGGCTGTGGTGGG + Intronic
1130963680 15:88681838-88681860 ATGGATCAGCAGCCTGTGGCCGG + Intergenic
1132394288 15:101460423-101460445 ATGTAGGAGGAGCAGGTGTTTGG - Intronic
1132746598 16:1438810-1438832 CTGCAGGGGCAGCATGAGGTGGG - Exonic
1132869672 16:2110251-2110273 ATAGAGGGGCTGCAGGTGGTGGG - Exonic
1132906777 16:2286541-2286563 ATGGTGGAGGAGGATGTGGCAGG + Intronic
1132907721 16:2291703-2291725 CTGGAGGAACAGCCTGGGGTGGG - Intronic
1132923080 16:2410076-2410098 TAGGAGGAGCAGCAGGTTGTGGG + Intergenic
1133047981 16:3099733-3099755 ATGGAAGAGGAGGATGTGATGGG + Intergenic
1133204338 16:4224006-4224028 AGAGAGGAGCAGCTGGTGGTCGG + Intronic
1133975091 16:10594891-10594913 ATGGAGGAGGGGCATGTGCACGG - Intergenic
1134619164 16:15674651-15674673 ATGGGAGAGCAGCATGTACTTGG - Intronic
1134717746 16:16365351-16365373 ATAGAGGGGCTGCAGGTGGTGGG + Intergenic
1134957006 16:18386808-18386830 ATAGAGGGGCTGCAGGTGGTGGG - Intergenic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138552390 16:57754808-57754830 ATGGAGCAGGAGCATGGGGGAGG - Intronic
1138796450 16:59975361-59975383 GTGGAGGATTAGAATGTGGTAGG + Intergenic
1139504591 16:67392646-67392668 GTGGAGGAGGGGGATGTGGTGGG - Intronic
1141334857 16:83145088-83145110 TTGGAGGAGCAGCATATGGATGG - Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143474216 17:7193620-7193642 TTGGGGGAGCAGCAAGTGCTGGG + Intronic
1144772843 17:17769470-17769492 CTGGAGGAGCAGAAAGTAGTAGG + Intronic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1147403452 17:40194492-40194514 AGGGAGTAGCAGCAGGTGGGAGG + Exonic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1149161694 17:53701346-53701368 ATGGAGATGGAGCAAGTGGTAGG + Intergenic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1151249236 17:72820816-72820838 AGGGAGGAGAAACATGTGGATGG + Intronic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1152096209 17:78273145-78273167 ATGGGGGAACAGCAGGAGGTAGG + Intergenic
1152127182 17:78454258-78454280 CTGCAGGAGCAGCAGGTGATGGG + Intronic
1152474771 17:80510791-80510813 AGTGAGGAGCAGCATGGGGTTGG + Intergenic
1154457541 18:14543812-14543834 ACTGAGGAGAAGCCTGTGGTGGG + Intergenic
1155459947 18:26067667-26067689 ATGGAGTAGCAGCATTTAATGGG + Intronic
1155774152 18:29737733-29737755 CTGGCAGAGCAGCATGTGGGAGG + Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1157172991 18:45425204-45425226 ATGGAGGGTCAGCATTTGGATGG - Intronic
1158686571 18:59620327-59620349 TTGGAGGAGAAGAATTTGGTTGG + Intronic
1160213815 18:76908492-76908514 CTGGAGCCTCAGCATGTGGTGGG + Exonic
1160553009 18:79707101-79707123 AGTGAGGAGGAGCATGTGGAAGG + Intronic
1160728489 19:629615-629637 GTGGACGACCAGCAGGTGGTGGG + Exonic
1161170770 19:2811539-2811561 CTGGAGGAGGAGCATGGGGTGGG + Intronic
1161700702 19:5793443-5793465 ATTGAGGAGGCCCATGTGGTTGG + Intergenic
1162916477 19:13877062-13877084 AGGGAGGAGCAGGCTGTGGGAGG - Intronic
1163353738 19:16796094-16796116 ATGGGGGAGGGGCAGGTGGTAGG + Intronic
1163737697 19:18991488-18991510 TTGGAGGAGCGGCAGGAGGTGGG + Intronic
1164081136 19:21862346-21862368 ATGGAGGTGAAGGATGTGGAAGG - Intergenic
1164305927 19:24003856-24003878 AGGGAGGAGCAGCATTTGGCCGG + Intergenic
1164846723 19:31438787-31438809 ATTGTGGAGCAGCAGGTGGTAGG - Intergenic
1165110412 19:33498914-33498936 CTGGAGGGGCAGCCTGGGGTGGG - Intronic
1165500908 19:36188423-36188445 ATGAGGGGGCCGCATGTGGTAGG + Intronic
1165856815 19:38883878-38883900 AGGGAGGAGAAGCAAGTGGCAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
925282647 2:2695555-2695577 ATGGATGAGAAGATTGTGGTAGG - Intergenic
925337483 2:3108795-3108817 ATGGAGGAGCAGCGTGGAGCCGG - Intergenic
926166483 2:10524433-10524455 GTGGAGGAGCAGCAGCTGGAGGG + Intergenic
927078788 2:19607506-19607528 ATGGAAGAGAAGCACGTGGTAGG - Intergenic
928716260 2:34064133-34064155 ATGGGGGAGCAGCCTGTTGGTGG + Intergenic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
929486293 2:42357921-42357943 CTGGAGGAGAAGCATTGGGTAGG - Intronic
929858000 2:45651818-45651840 CTGGAGGTGCAGCTGGTGGTCGG + Exonic
933010869 2:77061719-77061741 ATGGATGGGCATTATGTGGTAGG - Intronic
933258737 2:80108478-80108500 ATGGAGGAGTGGCATGTGCCAGG - Intronic
933323457 2:80806381-80806403 ATGTAGGAGGAGCCTGTGGCAGG + Intergenic
934987335 2:98897093-98897115 ATAAAGGAGCAGCATGGGGGAGG - Intronic
936281681 2:111146462-111146484 AGGGTGGAGCAGCGTGTGTTTGG + Intronic
936345962 2:111675281-111675303 ATTGAGGAGCAGAAAGTTGTTGG + Intergenic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
938654763 2:133419738-133419760 AAATAGAAGCAGCATGTGGTAGG - Intronic
940004992 2:149002040-149002062 ATGGAGGAGGAGCCTGTGGAGGG + Intronic
943753269 2:191532041-191532063 ATGGAAGGGCAGCATATGGGTGG + Intergenic
945575217 2:211522544-211522566 ATGGAGGAGCAGCAGGGTTTGGG + Intronic
946030207 2:216697635-216697657 AGGGGGGAGGAGAATGTGGTGGG + Intergenic
946645461 2:221828614-221828636 ATGGAGGAACAGCCGGTGGGTGG + Intergenic
947047887 2:226008863-226008885 ACGGAGGAGGGGCAGGTGGTGGG + Intergenic
947598804 2:231431789-231431811 ATGGTGGAGCAGGATATGGAAGG + Intergenic
947671645 2:231940755-231940777 ATGCAGGACCAGGATGGGGTTGG - Intergenic
947841413 2:233210151-233210173 ATGGAGGAAGAGCATGAGCTGGG - Intronic
948198826 2:236114873-236114895 TTGCAGGAGCAACATCTGGTTGG - Intronic
948772135 2:240257060-240257082 ATGGTGGAGCAGCACATGGGAGG + Intergenic
948915846 2:241034739-241034761 ACAGAGGAGCAGCTTGGGGTGGG + Intronic
948939611 2:241189327-241189349 ATGGAGGCGCCGCAGGAGGTCGG - Intronic
1171561846 20:26134145-26134167 AAGGAGGAGTCGCCTGTGGTAGG - Intergenic
1171752280 20:29062955-29062977 ATGGAAGGGCAGCGTGTGGAAGG - Intergenic
1172936604 20:38624969-38624991 ATGGAGGAGGGGAATGTGCTTGG - Intronic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173896471 20:46554868-46554890 AGGGAGGAGGAGCATGGGGAGGG - Intergenic
1175126022 20:56752075-56752097 AAGGAAGGGAAGCATGTGGTGGG + Intergenic
1175199657 20:57268273-57268295 ATGGATGAAGAGCAGGTGGTGGG - Intergenic
1175901763 20:62362709-62362731 TCGGAGGAGCAGCAGGTGCTTGG - Intronic
1175935599 20:62512549-62512571 ATTAAGGAGCAGCAGGGGGTGGG - Intergenic
1175950616 20:62581351-62581373 ATGCAGGTCCAGCATGAGGTGGG - Intergenic
1176816616 21:13609526-13609548 ACTGAGGAGAAGCCTGTGGTGGG - Intergenic
1177096749 21:16845047-16845069 CTGGAGGACCAGCCTATGGTTGG - Intergenic
1177817091 21:25989062-25989084 ATGGAGGAGCATTTTGTGATAGG - Intronic
1178688111 21:34727560-34727582 ATGGATGAGAGGCAGGTGGTGGG - Intergenic
1179250149 21:39665254-39665276 GTGGAGGGGCAGGAGGTGGTTGG - Exonic
1179482253 21:41685734-41685756 ACCCAGGAGCAGCCTGTGGTTGG - Intergenic
1179789739 21:43749559-43749581 ATACTGGAGCAGGATGTGGTGGG + Intronic
1180244766 21:46539604-46539626 AGGAAGGTGCTGCATGTGGTGGG - Intronic
1181277371 22:21695275-21695297 ATGTGGGAGCAGCAGGTGGGAGG + Intronic
1181308148 22:21928519-21928541 CTGAAGGAGCAGCAGGTGGGTGG + Intronic
1181478611 22:23183334-23183356 ATGGAGGAGTTGAATGTGCTTGG + Intronic
1181774329 22:25148583-25148605 AGGGAGGAGCATCTTGTGATGGG + Intronic
1181913778 22:26262719-26262741 AAGGAGGACCAGCATGTGCATGG + Intronic
1182021847 22:27088323-27088345 ATGGAGAAGCCACATGTGGGTGG - Intergenic
1182181949 22:28358779-28358801 ATGGAGGAGCTACAGGTAGTGGG + Intronic
1183035458 22:35137802-35137824 ATGGAGGAACGGCATGTGTGTGG + Intergenic
1183632463 22:39041511-39041533 GTGGAGGAGGAGCGTGTGTTTGG - Intronic
1183638286 22:39077907-39077929 GTGGAGGAGGAGCGTGTGTTTGG - Intronic
1184308996 22:43628963-43628985 ATGAAGGAGCAGCATTTCCTAGG + Intronic
1184658146 22:45952438-45952460 ATGGAGGAAGAGCATCTGGATGG + Intronic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184760764 22:46542801-46542823 ATGGGGGTGCAGCCTGTGGGGGG - Intergenic
1185039106 22:48495391-48495413 ATGGGGGAGCAGCCTGGGCTAGG + Intronic
949517935 3:4824187-4824209 CTGGAGGAGCAGTCTGTGCTGGG + Intronic
949537838 3:5009665-5009687 AGGCAGGAGCAGCGTGTGCTGGG + Intergenic
952343296 3:32462990-32463012 ATGGAGGTGCAGGATATGGAAGG + Intronic
953875357 3:46663573-46663595 CAGGAGGGGCAGCATTTGGTTGG - Intergenic
954715991 3:52527259-52527281 TGGGGAGAGCAGCATGTGGTGGG - Intronic
955071879 3:55578406-55578428 AAGGAGGTGCAGACTGTGGTAGG - Intronic
955542170 3:59989011-59989033 ATTGAGGAGCAGTTTGGGGTAGG + Intronic
961095039 3:124147205-124147227 CTGGAGGGGCTGCATGGGGTGGG - Intronic
962845967 3:139274164-139274186 AGGGAGGAGCTGCATGGGGCTGG - Intronic
963320084 3:143801844-143801866 ATGGTGGTGCAGGATGTGGAAGG - Intronic
964469452 3:157037074-157037096 GAGGAGGAGCAGCATCTGTTGGG + Intronic
969126479 4:4951945-4951967 CTGGGGGAGCTGCATGTGGCAGG - Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971144184 4:23959188-23959210 ATTGAGGAGCACCATATGGTGGG - Intergenic
971641497 4:29138883-29138905 ATGTATGAGGAGCATGTGTTAGG - Intergenic
972734336 4:41826186-41826208 CTGGAGGAGGAGCAAGTGGGTGG - Intergenic
973289989 4:48461522-48461544 ATGATGGAGCTGCAAGTGGTAGG + Intergenic
973832745 4:54778593-54778615 ATGGAGGAGCATTCCGTGGTGGG - Intergenic
974514182 4:62886875-62886897 ATTGAGGAGTTGCATGTTGTGGG - Intergenic
975108728 4:70599592-70599614 ATGGAAGAGAGGAATGTGGTGGG - Exonic
978157454 4:105506095-105506117 ATTGAGAAGGAGCATGTTGTGGG - Intergenic
978408370 4:108403387-108403409 ATGGAGCAGCAACATGTAGAGGG - Intergenic
978615115 4:110586642-110586664 ATGGTGGGGTAGGATGTGGTGGG + Intergenic
980547185 4:134280806-134280828 ATGGAGGTGCAGCATTTTGCAGG - Intergenic
980855695 4:138436661-138436683 AAAGAGGAGAAGCATGTGGAAGG + Intergenic
981002527 4:139841503-139841525 ATAGTGAAGCAGCATCTGGTGGG - Intronic
981304530 4:143232507-143232529 AAGGAGGTGCAGCATCTGGTGGG - Intergenic
981455126 4:144944846-144944868 ATGGAGGATCATCATGAGGCAGG - Intergenic
983163460 4:164446729-164446751 ATCCTGGAGCAGCTTGTGGTGGG + Intergenic
983951104 4:173642593-173642615 CTGCAAAAGCAGCATGTGGTAGG - Intergenic
984016223 4:174429821-174429843 AGGGAGGCTCAGCAAGTGGTTGG + Intergenic
984469806 4:180154295-180154317 ATGGACCAGCAGCTAGTGGTAGG + Intergenic
985390458 4:189487220-189487242 CTGGGCTAGCAGCATGTGGTAGG + Intergenic
985434763 4:189917661-189917683 ATGGAAGGGCAGCACGTGGAGGG - Intergenic
985965065 5:3333263-3333285 ATGGAGGAGCAGGACGTGCATGG - Intergenic
987165510 5:15194134-15194156 AGGGAGCACCAGCATGTGATGGG + Intergenic
988987957 5:36639096-36639118 CTGGAGAAGCAGTGTGTGGTAGG + Intronic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992005142 5:72470272-72470294 ATGGGAGAGCAGCATCTGGTGGG - Intronic
992425183 5:76649758-76649780 ATGGAGGAGAAGTGTGGGGTTGG - Intronic
993127299 5:83851234-83851256 AGGGAGGAGCCGCATGTACTTGG - Intergenic
993712025 5:91234787-91234809 ATGAAGGAGGAGCATGTTTTAGG + Intergenic
993955575 5:94228475-94228497 ATGGAGGAACAGGAGGTGGGAGG - Intronic
995534529 5:113121816-113121838 AGGGAGGAGCAGCATATCTTAGG - Intronic
996128822 5:119756136-119756158 ATGGAGGAGATGCATCTAGTAGG + Intergenic
997280708 5:132642971-132642993 ATGTAGGAGAAGAAGGTGGTGGG - Exonic
997385025 5:133465629-133465651 ATGGAGGAGCACAGTGGGGTTGG + Intronic
997653999 5:135542207-135542229 ATGGGGGGACAGCATGTGCTTGG + Intergenic
998830492 5:146152586-146152608 ATGGACCAGCAGGGTGTGGTAGG - Intronic
999339588 5:150758669-150758691 AAGGAGGAGCAGCCTCGGGTGGG - Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000171326 5:158705731-158705753 AGGAAGGAGCAGGAAGTGGTTGG - Intronic
1001260010 5:170220252-170220274 CTGGAAGTGCAGCATCTGGTGGG - Intergenic
1001654414 5:173338582-173338604 CTGGAGGCCCAGCATGTGGTGGG + Intergenic
1002022690 5:176374823-176374845 TTGCAGGAGCAGCTAGTGGTTGG - Exonic
1003313288 6:4987558-4987580 GTGGTGGAGCAGGATGTGGAGGG - Intergenic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1005365790 6:25075532-25075554 ATGGAGGAATAGCATGTGGGTGG + Intergenic
1006787163 6:36676295-36676317 GCGGTGGAGCAGCATGGGGTAGG - Intergenic
1007034720 6:38662633-38662655 TGGGTGGTGCAGCATGTGGTAGG + Intergenic
1008322374 6:50132603-50132625 ATGGAGGAAAAGCATCAGGTAGG - Intergenic
1008735711 6:54541342-54541364 ATGGAGAAGCATCATGTCCTGGG - Intergenic
1011452316 6:87506891-87506913 ATGGAGTAGGATCATGAGGTGGG + Intronic
1013013132 6:106137528-106137550 ATAAAGGATCAGCATGTAGTAGG + Intergenic
1016757389 6:147701784-147701806 ATGGATGATCAGCTTGTGTTTGG - Intronic
1017151554 6:151285001-151285023 ATGCAGTATGAGCATGTGGTGGG + Intronic
1018740152 6:166722380-166722402 ATGGAGGAGCCGCAGGGGGTGGG + Intronic
1018919504 6:168161515-168161537 GGGGAGGAGCAGCATGGGGAGGG - Intergenic
1019446935 7:1076259-1076281 AGGGAGGAGCACCATGAGGGAGG + Intronic
1022530886 7:31066199-31066221 ATGGAGGATCAGGCTGAGGTGGG + Intronic
1023420991 7:39979598-39979620 ATGGAAGAGGAGGATGTGGTAGG + Intronic
1024066911 7:45745779-45745801 ATGTGGGAGGAGCATGTGGGAGG + Intergenic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1026447751 7:70500324-70500346 ATGAACCAGCAGCTTGTGGTGGG + Intronic
1027354639 7:77343404-77343426 ATGGAGGTGCAGGATATGGAAGG - Intronic
1031787502 7:126052553-126052575 AAGGAGGCACAGAATGTGGTAGG + Intergenic
1033582683 7:142751520-142751542 GTTGAGGAGCAGCCTCTGGTGGG + Intronic
1033585701 7:142773012-142773034 ATTGAGGAGCAGCCTCTGGTGGG + Intergenic
1033622934 7:143078170-143078192 ATAGAGGAGGATCAGGTGGTGGG - Intergenic
1034101954 7:148457841-148457863 ATGGGGGAGAAGGGTGTGGTTGG - Intergenic
1034435523 7:151061193-151061215 ATGGGGGAGGGGCATGTGATGGG - Intronic
1035921919 8:3686451-3686473 ATGCCAGAGCAGCATATGGTGGG - Intronic
1036012928 8:4748151-4748173 ATGGAGTAGAAACATGTTGTGGG - Intronic
1036211124 8:6842056-6842078 ATGGAGCAGGAACATTTGGTTGG + Intergenic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1038336160 8:26647350-26647372 GGGGAGGAGCAGCAAGAGGTTGG - Intronic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1041003973 8:53481508-53481530 AAGGATGAGCAGCATGGGGATGG - Intergenic
1042614595 8:70634463-70634485 ATGGCAGAGCATCATTTGGTTGG - Intronic
1042695874 8:71554886-71554908 ATGTACAAGCAGTATGTGGTGGG + Intronic
1045250229 8:100476706-100476728 TTGGAGAAGGAGCATCTGGTTGG + Intergenic
1045632033 8:104135660-104135682 ACAGAGAAGCAGCATGTGGTAGG + Intronic
1048369278 8:133763652-133763674 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1048369284 8:133763704-133763726 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1048398106 8:134034247-134034269 AAGGAGGGGCAACATGGGGTTGG + Intergenic
1049006409 8:139858441-139858463 ATGGAAGAGCTGCATGCGGCTGG - Intronic
1049436140 8:142587131-142587153 AAGGAGGAGCAGCGTGTAGAAGG + Intergenic
1049557487 8:143290380-143290402 ATAAACGTGCAGCATGTGGTGGG + Intronic
1051017774 9:12501627-12501649 ATGAAGAAACAGTATGTGGTGGG + Intergenic
1051775958 9:20634406-20634428 GTCGAGGAGCAGGGTGTGGTTGG + Intergenic
1052901413 9:33797575-33797597 GTTGAGGAGCAGCCTCTGGTGGG + Intronic
1054972965 9:71110087-71110109 ATTGGGGAGCAGTGTGTGGTGGG - Intronic
1057903376 9:98966327-98966349 ATGGGGGTGCAGCATTGGGTTGG - Intronic
1058593636 9:106591570-106591592 GGGGAGGAGCAGCAGGAGGTGGG + Intergenic
1058810289 9:108632482-108632504 ATGGACCAGCAACATATGGTGGG + Intergenic
1059469544 9:114494256-114494278 CAGGAAGAGCAGCATCTGGTAGG + Intronic
1203530740 Un_GL000213v1:139941-139963 ACTGAGGAGAAGCCTGTGGTGGG + Intergenic
1185891590 X:3826981-3827003 ATGAATGAGCAAAATGTGGTAGG + Intronic
1186732075 X:12420569-12420591 ATGAAGGATCAGCATGTGTGAGG - Intronic
1188405866 X:29809062-29809084 AAGCAGGAGCAGAATATGGTAGG - Intronic
1189206012 X:39239418-39239440 ATGGAGGAGTGGCATGGGATGGG + Intergenic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1190750457 X:53357521-53357543 ATGGATGGGAAGCATGTGGCAGG + Intergenic
1190801659 X:53794976-53794998 ATGGATGGGAAGCATGTGGCAGG + Intergenic
1192470133 X:71391221-71391243 ATGGAGGAGTAGTGTGTAGTTGG + Intronic
1193537395 X:82731226-82731248 ATGGTGGTGCAGCATATGGAAGG - Intergenic
1195699408 X:107691256-107691278 ATAGTGGAGCAGCATGTGCGTGG - Intergenic
1196684045 X:118495778-118495800 AGGGAGGAGCAGCGGGTGGGAGG + Intergenic
1197899357 X:131353564-131353586 ATGGGGTAGCAGCAGATGGTTGG + Intronic
1197977641 X:132182550-132182572 ATGGAGGGGCAGCCTGGTGTGGG - Intergenic
1198235742 X:134734542-134734564 ATGGAAGAGCAGCCTGTGAGAGG - Intronic
1198282192 X:135153403-135153425 ATGGAGGAGGGGCATTTGGGAGG - Intergenic
1198288767 X:135219119-135219141 ATGGAGGAGGGGCATTTGGGAGG + Intergenic
1198710293 X:139494552-139494574 GGGGAGGAGCAGGGTGTGGTAGG - Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199440851 X:147866439-147866461 CTGCAGCAGCAGCATGGGGTGGG + Intergenic
1200070412 X:153526295-153526317 CTGGAGGAGCAGCTGGTGGTGGG + Intronic
1200146225 X:153927744-153927766 ATGGAGGGGCAAGATGTGTTGGG - Intronic
1201233969 Y:11892446-11892468 ATGGTGGTGCAGGATGTGGAAGG + Intergenic