ID: 1003823715

View in Genome Browser
Species Human (GRCh38)
Location 6:9928812-9928834
Sequence CAGTAGGAATGGTGGAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003823715_1003823720 9 Left 1003823715 6:9928812-9928834 CCATTATTCCACCATTCCTACTG 0: 1
1: 0
2: 3
3: 17
4: 210
Right 1003823720 6:9928844-9928866 CAAAAAAAAAAAAAAAAAAGAGG 0: 465
1: 8324
2: 36226
3: 46925
4: 92486
1003823715_1003823721 15 Left 1003823715 6:9928812-9928834 CCATTATTCCACCATTCCTACTG 0: 1
1: 0
2: 3
3: 17
4: 210
Right 1003823721 6:9928850-9928872 AAAAAAAAAAAAAGAGGAAGAGG 0: 18
1: 406
2: 3387
3: 19530
4: 73648
1003823715_1003823722 16 Left 1003823715 6:9928812-9928834 CCATTATTCCACCATTCCTACTG 0: 1
1: 0
2: 3
3: 17
4: 210
Right 1003823722 6:9928851-9928873 AAAAAAAAAAAAGAGGAAGAGGG 0: 13
1: 311
2: 2215
3: 12339
4: 64087

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003823715 Original CRISPR CAGTAGGAATGGTGGAATAA TGG (reversed) Intronic
903088288 1:20883913-20883935 CAGTAGAAATGTTGTAATAGAGG + Intronic
907267067 1:53268870-53268892 CAGTAATAATGTGGGAATAAGGG + Intronic
907586999 1:55628121-55628143 GAGTATGAATGGAGGAAGAAAGG - Intergenic
908384439 1:63627667-63627689 CATAAGGAATGGTAGAATTAAGG + Intronic
911268501 1:95772711-95772733 AAGGAGGAAGAGTGGAATAAAGG - Intergenic
911574307 1:99556846-99556868 CAGTAGGAAGGGAAGAAGAATGG - Intergenic
912546566 1:110455574-110455596 CAGTATGAAGGGTGGCATACAGG - Intronic
912886417 1:113479255-113479277 CATTGGGACTGGTGGAACAATGG - Intronic
912927246 1:113924201-113924223 TAGCAGAAATGATGGAATAATGG - Intergenic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
916897616 1:169181906-169181928 CAGTAGGAAGGTGGAAATAAAGG - Intronic
917525535 1:175785074-175785096 CAGTAGGAAGTGAGGAAGAAAGG - Intergenic
919619016 1:199843817-199843839 CAGAAGGATTGGTGGAAGGAAGG - Intergenic
923290161 1:232537598-232537620 CAGGAGCAATGGTGTAATAATGG + Intronic
923639420 1:235738821-235738843 CACCATGATTGGTGGAATAAAGG + Intronic
1063117719 10:3084007-3084029 CCACAGGAATGGTGGAATACAGG - Intronic
1064058436 10:12117345-12117367 CAGTGGGGATGGTGGAGTAGGGG + Intronic
1066392539 10:34989885-34989907 AAGTAGGAAAGGTAAAATAAAGG - Intergenic
1067710705 10:48649178-48649200 CAGTTGGAATGGGGTAATAAGGG - Intronic
1068787583 10:60993080-60993102 CAATGGAAATGGTGGAATGATGG + Intronic
1072148546 10:92666023-92666045 CAGTAGGAGTGGTGGCATAAGGG - Intergenic
1072175853 10:92921166-92921188 CAGTACTAATGGAGGAATAGAGG - Intronic
1076001482 10:126916636-126916658 CAGAAGGAATGAGGGAAGAAGGG - Intronic
1077468426 11:2745129-2745151 AAGTTGGCATGGAGGAATAAAGG - Intronic
1079193898 11:18306972-18306994 GAGGAGGAATGATGGAATCATGG - Intronic
1080678081 11:34446435-34446457 GAGTGGGAATGCTGGAATTATGG - Intronic
1085236684 11:75020787-75020809 CAGTGGGACTGGGGCAATAAGGG + Intergenic
1086636621 11:89096824-89096846 CCGTAGAAATGCTGGCATAAAGG - Intergenic
1087398666 11:97635534-97635556 CAGAAGGAATGGTGGAAGGAAGG + Intergenic
1089286545 11:117411283-117411305 CAGCAGGACTGGGGGAATAAGGG - Intronic
1090114292 11:123951172-123951194 CAGCAGGAAAGGTAGAATAAAGG - Intergenic
1090250993 11:125251697-125251719 CAGCAGGAATGGAGGAAGAGAGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091224321 11:133948572-133948594 CAAGAGGAATGGGTGAATAATGG + Intronic
1092392644 12:8094891-8094913 CGTTAGGAATGGGGGAAGAAAGG - Intronic
1093258022 12:16896535-16896557 CAGCACAAATGGTTGAATAATGG - Intergenic
1093672433 12:21893168-21893190 AAGTAAAAATGGTGGAAAAATGG + Intronic
1094239343 12:28203347-28203369 CAGCAGGAATAGTGGAGTTAAGG - Intronic
1094767617 12:33615992-33616014 CAGTAAGAATTGTACAATAATGG + Intergenic
1095154769 12:38839146-38839168 CAGTAGGAAGGGCTGAATGAGGG - Intronic
1095912347 12:47441480-47441502 CACTAGGAATGGTGGAGTAAAGG - Intergenic
1096356114 12:50942389-50942411 CAGAAGCAATGGGGGAAGAAAGG - Intergenic
1097097796 12:56563553-56563575 AATTAGGAATGTTGGAAAAATGG + Intronic
1097143210 12:56920926-56920948 AAGAAGCAATGGTGGAAGAAAGG - Intergenic
1099186797 12:79523756-79523778 CAGTAGGAAGGGAGGAAGAAGGG - Intergenic
1099246960 12:80203508-80203530 CACTATGATTGGTGGAATAATGG - Intergenic
1099580538 12:84441214-84441236 CAGTGGGAAAGGTGGTATAGAGG - Intergenic
1101212883 12:102552120-102552142 CAAAAGGAAAGGAGGAATAAAGG - Intergenic
1101600002 12:106201086-106201108 CTGGATGAATGATGGAATAAAGG + Intergenic
1103527283 12:121577367-121577389 CAGTAAAAATGGGGGAAGAAAGG + Intronic
1107297563 13:38927459-38927481 AGGTATGAATGGGGGAATAAAGG + Intergenic
1110268456 13:73566538-73566560 CAGTGTGGAAGGTGGAATAATGG + Intergenic
1111707986 13:91775327-91775349 CAGTAGAAATGGTGGTAAAATGG - Intronic
1112831626 13:103459617-103459639 CAGGAGAAATGGTGGAATTGGGG + Intergenic
1114806253 14:25840581-25840603 CAGTATGAACGGTGGATTGAAGG - Intergenic
1115881497 14:37924199-37924221 CATTATGAATGGTAGAATTAGGG + Intronic
1116229862 14:42202790-42202812 AAGTAGGAAAGGTGGAGCAAGGG - Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1117015310 14:51511722-51511744 CAGTTGGGATGGTGGACTAGGGG + Intronic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1118858521 14:69643210-69643232 CTCTAGTCATGGTGGAATAATGG - Intronic
1119370078 14:74132342-74132364 CAGCAGGAACTGTGAAATAAAGG - Intronic
1120171867 14:81254395-81254417 CAGACTGAATGGTGGAACAAAGG - Intergenic
1123162902 14:106297014-106297036 TAGTGGGATTGGTAGAATAAAGG + Intergenic
1123501236 15:20882920-20882942 CAGCAAGGATGTTGGAATAAGGG - Intergenic
1123558488 15:21456625-21456647 CAGCAAGGATGTTGGAATAAGGG - Intergenic
1123594719 15:21893900-21893922 CAGCAAGGATGTTGGAATAAGGG - Intergenic
1125992814 15:44126723-44126745 CAAAAGGAAGGGTGGAACAATGG - Intronic
1130056988 15:80534877-80534899 CAGTAGGAGTGTGGGAAAAAAGG - Intronic
1131006801 15:88985026-88985048 CATTTGGAATGTTGGAATGATGG + Intergenic
1132424468 15:101702999-101703021 CAGTAGGTATGGGGAAGTAAAGG + Intronic
1202966838 15_KI270727v1_random:183775-183797 CAGCAAGGATGTTGGAATAAGGG - Intergenic
1136772408 16:32852745-32852767 TAGTGGGATTGGTAGAATAAAGG - Intergenic
1136898207 16:34008772-34008794 TAGTGGGATTGGTAGAATAAAGG + Intergenic
1138033177 16:53577454-53577476 CACTAGGAGTGGTGGTAAAAGGG + Intergenic
1139026123 16:62820358-62820380 AAGTAAGAATGCTGAAATAATGG - Intergenic
1140820780 16:78661097-78661119 CAGCAGAAGTGGTGGAACAAAGG + Intronic
1140959394 16:79897604-79897626 CAGCAGGGCTGGTGGAATCAAGG - Intergenic
1203074830 16_KI270728v1_random:1114843-1114865 TAGTGGGATTGGTAGAATAAAGG - Intergenic
1143877263 17:10001484-10001506 CAGCAGGAATCGGGGAAAAAAGG + Intronic
1148386096 17:47236290-47236312 CAGTTGGGAAGGTGGAATGAGGG + Intergenic
1148630634 17:49105569-49105591 CTGGAGGAAGGGAGGAATAAAGG + Intergenic
1152458042 17:80427221-80427243 GAGTTGGAATGGAGGAAGAAAGG - Intronic
1153632692 18:7087308-7087330 GAATAGGAATGGGTGAATAAGGG + Intronic
1158073856 18:53505798-53505820 CAGAAGGAATGGTGAAGGAAAGG + Intronic
1160502536 18:79409385-79409407 GACGAGGAATGGAGGAATAATGG - Intronic
1161757866 19:6147698-6147720 CAGAATGAATGGTTGAACAAAGG - Intronic
1163988968 19:20980705-20980727 CAGAAAGAGTGGTGGAATGAGGG - Intergenic
926335926 2:11862750-11862772 CAGAGAGAATGGAGGAATAATGG + Intergenic
926657997 2:15430735-15430757 GAGGGGGAATGGTGGAAAAATGG - Intronic
928871527 2:35986715-35986737 CAGTAGTAATGAAGGTATAAAGG + Intergenic
928941350 2:36730507-36730529 CAGTAGGAAGGGATGAAGAAGGG + Intronic
931511356 2:62999160-62999182 CATTAGGAATGGTGGAGTTACGG + Intronic
932321585 2:70826231-70826253 CAGGAGGAATGCTCCAATAACGG + Intergenic
933867831 2:86539001-86539023 CGGGGGGAATGGTGGATTAAAGG - Intronic
936641451 2:114316461-114316483 CAGTAGTATTTGTGGAATACAGG + Intergenic
936851447 2:116903542-116903564 CAGTAAGTAAGGTGGAAAAAAGG - Intergenic
938282719 2:130076484-130076506 CAGTAGTAATGGTGAAATAGGGG + Intronic
938333353 2:130465055-130465077 CAGTAGTAATGGTGAAATAGGGG + Intronic
938356460 2:130655616-130655638 CAGTAGTAATGGTGAAATAGGGG - Intronic
938432894 2:131262421-131262443 CAGTAGTAATGGTGAAATAGGGG - Intronic
938828614 2:135032049-135032071 CAGCAGAAATGGTGGTATGAGGG - Intronic
939098424 2:137864490-137864512 CAGAAGGAATTGCAGAATAATGG - Intergenic
939185641 2:138857439-138857461 CAGTAGTAATGGCAGAAAAATGG - Intergenic
939359796 2:141155958-141155980 CTGTAGGAATTATGGAAGAAAGG - Intronic
940326819 2:152434308-152434330 CAGGGGGTATGGAGGAATAAAGG + Intronic
940477162 2:154177653-154177675 CAGTAGGAATAGTGGGCTAGGGG + Intronic
945037116 2:205713885-205713907 CAGTAGGATTGCTGGATTAAAGG + Intronic
946581626 2:221134234-221134256 CAGGATGAATGGGTGAATAAAGG + Intergenic
946605231 2:221396980-221397002 GAGTACAAATGGTGGAAAAATGG + Intergenic
946854004 2:223934923-223934945 GAGTGGGAATGGTGGTATAGTGG + Intronic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948268173 2:236653861-236653883 GAGTAGGAATGGTGCAGTCAGGG - Intergenic
1169793369 20:9435651-9435673 AAGTAGAAATGGTTGATTAAAGG + Intronic
1170071835 20:12377678-12377700 CATAAGGAATGGTGAAATAGGGG - Intergenic
1170509015 20:17057976-17057998 ATGGAGGAGTGGTGGAATAAGGG + Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1174531740 20:51219863-51219885 CCCTAGGAATGGTGGAGCAATGG - Intergenic
1175115809 20:56681242-56681264 TAGTAGGAGTTCTGGAATAAAGG + Intergenic
1175700619 20:61134327-61134349 CAGCAGGAAAGGAGGAAGAATGG - Intergenic
1175772803 20:61634320-61634342 CAGAAGGAATGGTGAAACAAAGG + Intronic
1184022483 22:41830260-41830282 CAGTAGAAATGGTGGAAGAAGGG - Intergenic
1184096187 22:42317726-42317748 CAGTGGGGAGGGTGGAAGAAGGG + Intronic
1185202401 22:49516042-49516064 CATTAGGAAGGGTGGAACTATGG - Intronic
1185408213 22:50669028-50669050 CAGTAGGAATTGTTGGATACAGG - Intergenic
949199758 3:1361402-1361424 CAGTAGGAATGCTGAACAAAAGG - Intronic
951214853 3:20014283-20014305 CCCTAGGCATTGTGGAATAAAGG - Intergenic
952102786 3:30034513-30034535 CAGTAGGAAGGAAGGAAGAAAGG + Intergenic
952163736 3:30722907-30722929 CAGTAGCAACAGTGCAATAAAGG - Intergenic
953001864 3:38941750-38941772 AAGCAGGAATGGAGAAATAATGG + Intronic
953363456 3:42321743-42321765 CAGAAGGAATGTTGGCAGAAGGG - Intergenic
953686244 3:45080599-45080621 AAAAAGGAATGGTGGAATAGAGG + Intergenic
953805189 3:46062281-46062303 CAGGATGCATGGTGGAATGATGG + Intergenic
955115874 3:56001110-56001132 GAGAAGGAAAGGAGGAATAAAGG + Intronic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
956561559 3:70582280-70582302 AAGTAGGAATTGGGGAAAAAAGG + Intergenic
957026654 3:75190067-75190089 CAGTTTGACTGGAGGAATAAGGG + Intergenic
958043428 3:88253495-88253517 AAGTAGGAATTTTGGAACAAAGG - Intergenic
958054597 3:88393040-88393062 CAGGAGGAAAGGAGGAAGAATGG + Intergenic
963466688 3:145690485-145690507 AAGTAGGGATGGTGCAATATAGG + Intergenic
965443722 3:168748609-168748631 CAGGAGGAATGGTGGAGTACTGG - Intergenic
965603724 3:170479635-170479657 CAGTAAGGATGGTGGCATGATGG + Intronic
968462010 4:730894-730916 CAGTAGGAATGGCGGAGTTGTGG + Intronic
969045951 4:4336906-4336928 CAGTAGGAAGGGTCAAATACTGG + Intergenic
969165114 4:5301995-5302017 TAGAAGTAATGGAGGAATAATGG - Intronic
969418269 4:7075000-7075022 CAGTAGGAGTGGGGGAATTTGGG - Intergenic
971231874 4:24806720-24806742 CAGAAGGAAGGATGGAATACTGG + Exonic
971805053 4:31346883-31346905 CAATAGGCATTGTGGAATAGAGG + Intergenic
974579048 4:63770601-63770623 AAGAAGAAATGGTGAAATAAAGG + Intergenic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975406182 4:73993235-73993257 CAGTAAGAAGAGTGGAAGAAAGG - Intergenic
975724118 4:77275635-77275657 CACTTGGAATGATGGAAAAAGGG + Intronic
977746522 4:100555701-100555723 CAGTAGACATGGTGGCATGAAGG + Intronic
979000941 4:115218563-115218585 CAGTATGAGAGGTTGAATAAAGG - Intergenic
979366527 4:119831144-119831166 CAGTAGTAATAGTGGATCAAAGG + Intergenic
980670248 4:135995450-135995472 AAGGAGGAAAGGAGGAATAAAGG - Intergenic
982277704 4:153653513-153653535 CACTAGGAATGGTGGAAATGGGG - Intergenic
982833337 4:160090458-160090480 CAGTAGCAATTTTGGAATAGTGG + Intergenic
983715973 4:170781588-170781610 CGGCAGGAATGATGGAAGAAAGG - Intergenic
983967653 4:173832600-173832622 CAGTAGGAAGGGTGAGAGAAGGG - Intergenic
986160351 5:5222030-5222052 CAGTAGGACTTGTGAAATGATGG - Intronic
986763240 5:10899055-10899077 CAGTAGGAATGCTGGAGAGAGGG + Intergenic
988351160 5:30108776-30108798 CAGTGGGAAGTGTGGATTAAAGG + Intergenic
990980981 5:61602319-61602341 CAGTGGCACTGATGGAATAAGGG + Intergenic
992434582 5:76743120-76743142 CAGAAGGAATGGAGGAAATAAGG + Intergenic
992471380 5:77058833-77058855 CAGTACGAGTGGTTCAATAAAGG - Intronic
992568110 5:78022724-78022746 CAGTATGTAAGGTGGAGTAAGGG + Intronic
993072162 5:83178649-83178671 CAGTAGTAAAGGGGGATTAAGGG + Intronic
993248899 5:85488845-85488867 GTGTAAGAATGGTGGAAGAACGG - Intergenic
994879373 5:105468187-105468209 CAGAAGGAATGATGAAGTAAAGG + Intergenic
994947889 5:106419811-106419833 CAGAAGTAATGGGGGAAAAAAGG - Intergenic
995972677 5:117991631-117991653 TAGTAGGAATGAAGGACTAATGG + Intergenic
996794287 5:127327588-127327610 GAGTAGGCATAGTGGAAAAAGGG + Intronic
996996431 5:129701607-129701629 GAGTAGGAATGGGGAAAGAAAGG - Intronic
1002007215 5:176245204-176245226 CAGTAGTCATGTTGGATTAAGGG - Intronic
1002400619 5:178989831-178989853 CACAGGGAATGGTGGAACAAAGG + Intronic
1003054398 6:2805498-2805520 CAGAAGAAATGGTGCAATTAAGG - Intergenic
1003142844 6:3485947-3485969 CAGTTGGAGTTGTGGAATACAGG + Intergenic
1003214680 6:4098542-4098564 CAGTAATATTGTTGGAATAAAGG + Intronic
1003823715 6:9928812-9928834 CAGTAGGAATGGTGGAATAATGG - Intronic
1005289383 6:24364080-24364102 AAATAGGAATGGGGGGATAAGGG - Intergenic
1007003900 6:38341846-38341868 CAGCAGCAAAGGTGGAAGAAAGG + Intronic
1009417303 6:63429929-63429951 CGGAAGGAAAGGAGGAATAAAGG + Intergenic
1010274504 6:73953500-73953522 CAGGGGGAATGGTGGAAGAGAGG - Intergenic
1013725465 6:113090335-113090357 CAGTATTAATGGTGGAATCTGGG + Intergenic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1015087176 6:129309812-129309834 CAGTAGAAAGGCTGCAATAAGGG - Intronic
1015816141 6:137212580-137212602 CAGTAGGAATGGCTTTATAATGG + Intronic
1017333147 6:153222977-153222999 AAGTATTAATGGAGGAATAAGGG - Intergenic
1017618569 6:156271559-156271581 CTGTAGGGATGGTGGTATCATGG - Intergenic
1021458377 7:20856903-20856925 CAGTAGGCATAAGGGAATAAGGG + Intergenic
1021541630 7:21765781-21765803 CAGTATGTATGGTGGAAAAAAGG - Intronic
1023125887 7:36953908-36953930 CAGTAGGAACTTTGGAAGAAGGG + Intronic
1024675969 7:51638225-51638247 CAGTAGCACTGGTGGGATTAAGG - Intergenic
1028977365 7:96929059-96929081 TAGTAGAAATAATGGAATAATGG + Intergenic
1030086872 7:105823609-105823631 CTGAATGAATGGTGGATTAATGG + Intronic
1030635320 7:111941806-111941828 CAGAAGGAATGGCAAAATAAGGG + Intronic
1031739527 7:125412088-125412110 CAGGAGAAGTGCTGGAATAAAGG + Intergenic
1031861990 7:126990468-126990490 CAATGGGAATGGTGGAACAGAGG + Intronic
1032225994 7:130032300-130032322 CAGTGGGGATGGTGGAGGAAGGG - Intronic
1037692369 8:21192921-21192943 CAGCAGGAATGGTGGCCTGAGGG + Intergenic
1038342433 8:26697777-26697799 CTGTAGGGATGGTGGACCAAGGG - Intergenic
1038842720 8:31200919-31200941 CAGAAGGAAGGGATGAATAAGGG - Intergenic
1039164481 8:34662319-34662341 AAGTAGGAATTGTGGAATTGGGG + Intergenic
1039523044 8:38188168-38188190 AAGCAGTAAAGGTGGAATAAAGG + Intronic
1039732484 8:40294666-40294688 CAGTAGGAAATGTGGAATGGGGG + Intergenic
1040807926 8:51415205-51415227 CAGTAGGAATTGTAGAAAATTGG + Intronic
1042056505 8:64769797-64769819 CAGTAGGATGGGGGGAATGAAGG - Intronic
1044619871 8:94178905-94178927 CAGTGAGAAAGGTGGAGTAAGGG + Intronic
1045772494 8:105759699-105759721 TAGTAGGCATGGTGAAATGATGG + Intronic
1046961687 8:120120362-120120384 CTTCAGGATTGGTGGAATAAAGG + Intronic
1047181311 8:122590840-122590862 CAGTATGTATAGTAGAATAAGGG + Intergenic
1047251852 8:123186845-123186867 CATTAGGCTTTGTGGAATAAGGG - Intronic
1048115416 8:131516444-131516466 CATTGAAAATGGTGGAATAAAGG + Intergenic
1050706680 9:8407598-8407620 CATTTGGATTGGTGAAATAAAGG - Intronic
1053463581 9:38289152-38289174 CAGTGGGAATGGGAGAATCAAGG - Intergenic
1055419069 9:76117397-76117419 GAGTAGGAAAGGATGAATAATGG + Intronic
1058143291 9:101381115-101381137 CAAGAGGAAAGGAGGAATAAAGG + Intronic
1059537640 9:115097437-115097459 CAGAAGGGATGGGGGAATCAGGG + Intronic
1059875443 9:118629265-118629287 CAGCAGCAGTGGTGGAAAAAGGG + Intergenic
1059973067 9:119687275-119687297 CATGAGGAAAGGTGTAATAATGG + Intergenic
1060245896 9:121946068-121946090 CAGAAGGAATGCTGGATTTATGG - Intronic
1060456898 9:123806808-123806830 AAGAAGGAATGAAGGAATAAAGG + Intronic
1187438000 X:19290224-19290246 CAGAAGGCATGGTGCAGTAAAGG - Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1191671906 X:63755587-63755609 AAGAAGGAATGGGGGAAAAACGG + Intronic
1194866666 X:99077437-99077459 CAGTAGGAAAGATGAAATAGAGG - Intergenic
1195573301 X:106420998-106421020 CAGGAGCAGTGGTGTAATAAAGG - Intergenic
1198733812 X:139764155-139764177 CATTAGGTAAGTTGGAATAAGGG - Intronic
1199474316 X:148229080-148229102 CAGTAGTAAAGGTGGGACAAAGG - Intergenic
1201453836 Y:14146494-14146516 CAGCAAGAATAGAGGAATAAAGG - Intergenic