ID: 1003823980

View in Genome Browser
Species Human (GRCh38)
Location 6:9931908-9931930
Sequence GGCACAGATGTGTTCTCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003823980_1003823983 26 Left 1003823980 6:9931908-9931930 CCAGCCGAGAACACATCTGTGCC 0: 1
1: 0
2: 0
3: 13
4: 80
Right 1003823983 6:9931957-9931979 TTCCCTCTCTAAAAGCTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003823980 Original CRISPR GGCACAGATGTGTTCTCGGC TGG (reversed) Intronic
901296829 1:8167305-8167327 GGTGCAGATGTTTTCTCTGCAGG + Intergenic
902386437 1:16078506-16078528 GGTAAAGAGGTGTTCTGGGCTGG + Intergenic
902917241 1:19646066-19646088 GGCACAGAGGTGGTCAGGGCTGG + Intronic
905514674 1:38553631-38553653 GGCTCAGATGTTTTCTGGGGAGG - Intergenic
905962661 1:42057779-42057801 ATCACAGATGTGTTCTCTGATGG + Intergenic
907192219 1:52658955-52658977 CCCACAGAAGTGTTCTAGGCTGG + Intronic
913105400 1:115609620-115609642 GGTAGAGATGGGGTCTCGGCTGG + Intergenic
922413271 1:225396200-225396222 GGTTCAGATGTGTTTTCGACTGG + Intronic
922806701 1:228394056-228394078 GGCACAGATGTCTGTTCAGCAGG - Exonic
1064019467 10:11797529-11797551 GGCACAAATGTGTTCTCTGTGGG + Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1067165120 10:43859714-43859736 GGCACAGATTTGTTCACCTCAGG + Intergenic
1070129075 10:73644323-73644345 GGCACAAATGTGCCCTCTGCTGG + Intergenic
1070757072 10:78999895-78999917 TGTACACATGTATTCTCGGCGGG + Intergenic
1077777191 11:5284781-5284803 GGCCCAGATGGGTTATAGGCTGG - Intronic
1080328025 11:31100799-31100821 GGCATACATGTGTTTTCAGCAGG + Intronic
1083066594 11:59930345-59930367 GACTTGGATGTGTTCTCGGCAGG - Intergenic
1085110566 11:73884069-73884091 GGCACAGTTGTGTTCTTTTCTGG + Intronic
1088428769 11:109733868-109733890 GGCACTGATGACTTCTCAGCAGG - Intergenic
1091532689 12:1374777-1374799 TACACAGATGTGTTATAGGCAGG + Intronic
1091837873 12:3598491-3598513 TGCACAGATGTTTTCTTGGGAGG - Intergenic
1092111248 12:5966242-5966264 AGCCCAGATGTGTTCTAGGAGGG + Intronic
1096422679 12:51473697-51473719 GGCACAGGTGTGGTCTGGTCTGG + Intronic
1096845062 12:54401918-54401940 CTCACAGCTGTGCTCTCGGCTGG + Intronic
1102185386 12:110943641-110943663 AGCACAGATGTGGTCCTGGCTGG - Intergenic
1107875684 13:44788909-44788931 GGCACTGATGTGGTCTGGGCCGG - Intergenic
1109054425 13:57528785-57528807 GGCACAGATGAATTCTTGGCTGG - Intergenic
1111693422 13:91593024-91593046 GGCACAGATGGGTCTTCAGCCGG - Intronic
1115715252 14:36096494-36096516 TTCACAGATGAGTTCTCAGCTGG + Intergenic
1116013400 14:39377842-39377864 GGCACAGATAAATCCTCGGCTGG - Intronic
1117475461 14:56090171-56090193 GGCACTGATGGATTCTCAGCAGG - Intergenic
1117510987 14:56450421-56450443 GGCACAGATATATTCTTGGCTGG + Intergenic
1117981795 14:61348969-61348991 GACACAGAAGTGTTCCCTGCTGG + Intronic
1120019890 14:79516466-79516488 TGCACAGATGTGTTTTCATCTGG + Intronic
1122999722 14:105286851-105286873 GGTACATCTGTGTTCTCGCCCGG - Intronic
1128998733 15:72316146-72316168 GGCACATATGTTCTCTGGGCAGG - Intronic
1130027865 15:80285469-80285491 GGCAGAGAAGTGTCCTCAGCAGG + Intergenic
1139602720 16:67996413-67996435 GGCAATGATGTGATCTTGGCGGG + Intronic
1139737028 16:68999209-68999231 GGCACAGATGAATTCATGGCTGG - Intronic
1142051849 16:87964287-87964309 GGCATGGCTGTGTTCTCAGCAGG - Intronic
1142599794 17:1048050-1048072 GGCACGGAAGGGTTCTGGGCTGG - Intronic
1144090180 17:11849371-11849393 GCCACTGGTGTGTTTTCGGCAGG - Intronic
1146642841 17:34554084-34554106 GGCACATATGTGTTCAGGACTGG + Intergenic
1151787360 17:76281587-76281609 GGCACTGATCTGTCCTCAGCCGG + Intronic
1163625503 19:18387068-18387090 GGCACAGATGGGTTTAGGGCGGG - Intronic
933837670 2:86258900-86258922 GGGACAGATGTGTTCTAAGAGGG + Intronic
934162060 2:89258976-89258998 GGAACAGCTGTCTTCTCTGCAGG - Intergenic
934205222 2:89923386-89923408 GGAACAGCTGTCTTCTCTGCAGG + Intergenic
935223474 2:101034498-101034520 GGCACAGGAGTTTTCTGGGCTGG - Intronic
937419040 2:121739387-121739409 GGCACAGAGCTGACCTCGGCTGG - Intronic
938190736 2:129277859-129277881 GGCAAAGATGTGGTCTCAGCTGG - Intergenic
940068874 2:149662078-149662100 GGCACAGATGATTTCTCAGGTGG + Intergenic
948596533 2:239082913-239082935 GGCACACAGCTGTTCTCAGCGGG - Intronic
1169710087 20:8551463-8551485 GGCACAGATATGTTCTTCGAAGG + Intronic
1173875246 20:46366398-46366420 GGCACAGGTGTGGCCTCAGCCGG + Exonic
1174502602 20:50996682-50996704 AGCAAAGATGTGGTCTCAGCGGG + Intergenic
1175748528 20:61478481-61478503 GACACACATGTGTTCTCTGTTGG - Intronic
1179025690 21:37676654-37676676 GCCAGAGCTGTGTTCTCAGCAGG + Intronic
1183467429 22:37986759-37986781 GGCAGGGATGTGTTCGCAGCAGG - Intronic
951925614 3:27905962-27905984 AGCAAAGATGTGGTCTCAGCTGG - Intergenic
964453218 3:156832618-156832640 GGCACAGATGAATCCTTGGCTGG - Intronic
965755072 3:172017487-172017509 GGCACTCATATGTTCTTGGCAGG + Intergenic
966545157 3:181138108-181138130 GCCACAGGTGTTTTCTTGGCTGG - Intergenic
967969806 3:194990650-194990672 GGCACAGATGTGTGCTCCAGGGG - Intergenic
968975848 4:3821724-3821746 GGCACTGATGTGGTCTCAGCAGG + Intergenic
969134868 4:5021398-5021420 GGCACAGATGTGTTTTCTTCTGG + Intergenic
969674757 4:8608439-8608461 GGCCCAGCTATGTGCTCGGCCGG - Intronic
977530882 4:98199470-98199492 GGCACAGATGTGGCCCAGGCAGG + Intergenic
984781485 4:183530215-183530237 GTCACAGAGGTGTTCTCTGCTGG + Intergenic
990277887 5:54218329-54218351 GGCATAGCCGTCTTCTCGGCTGG - Intronic
991377653 5:65983704-65983726 GGCACACATGTATACTCGGCTGG - Intronic
991957662 5:72011950-72011972 GGTAAAGAGGTGTTCTCGGCCGG - Intergenic
1000021331 5:157321753-157321775 GGGAGAGGTGGGTTCTCGGCAGG + Intronic
1002163192 5:177328974-177328996 GGGACAGAGGGGATCTCGGCAGG + Intergenic
1003823980 6:9931908-9931930 GGCACAGATGTGTTCTCGGCTGG - Intronic
1005379092 6:25215807-25215829 GGCAGTGGTGTGGTCTCGGCTGG - Intergenic
1006441839 6:34058107-34058129 GGGACAGATGTGGTCTTTGCAGG + Intronic
1006610526 6:35291825-35291847 GGCACAGAAGGGTTCTGGGCTGG - Intronic
1017719612 6:157235701-157235723 GGCACAGACGTGTGCGGGGCCGG + Intergenic
1018909916 6:168095984-168096006 GGCACAGATGTGGTTTCTCCAGG + Intergenic
1019430293 7:996032-996054 GGCTAAGATGTGGTCTGGGCAGG - Intergenic
1023149171 7:37183612-37183634 AGCACAGATGTGCTCACAGCAGG + Intronic
1024679093 7:51664995-51665017 GGCAATGATGTGTTTTCAGCGGG + Intergenic
1025927721 7:65972813-65972835 GGCACAGGGGTGTGCTCAGCAGG - Intronic
1026846830 7:73703386-73703408 GGCACACAGGTGTTCGAGGCAGG - Intronic
1029283034 7:99449001-99449023 GGCAGAGATGTGCTCCCTGCTGG + Intronic
1034211519 7:149367637-149367659 GGCACAGGGGTGTTCCCTGCAGG - Intergenic
1041967803 8:63700608-63700630 GGCACACATGTGTTCCCTGCTGG - Intergenic
1044693414 8:94900253-94900275 GGCAGAGGTGTGCTCTCGGTGGG + Intronic
1052894071 9:33731200-33731222 AGCATAGATGTGTTCTCAGTGGG - Intergenic
1056429369 9:86511932-86511954 GGTACAGAGCTGTTCTCTGCAGG - Intergenic
1062570173 9:137181298-137181320 GGCACAGATGGGCTCTGAGCAGG + Intronic
1188634543 X:32412932-32412954 GGCAAAGCTGTGTTATAGGCTGG - Intronic
1193520416 X:82523107-82523129 GTGACAGCTGTGTTCTTGGCAGG + Intergenic