ID: 1003827014

View in Genome Browser
Species Human (GRCh38)
Location 6:9964346-9964368
Sequence AAGGGTAATCAAAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003827014_1003827019 -5 Left 1003827014 6:9964346-9964368 CCAGTTTCCCTTTGATTACCCTT 0: 1
1: 0
2: 4
3: 16
4: 311
Right 1003827019 6:9964364-9964386 CCCTTGTGTAAGACCTTTATGGG 0: 1
1: 1
2: 0
3: 7
4: 89
1003827014_1003827017 -6 Left 1003827014 6:9964346-9964368 CCAGTTTCCCTTTGATTACCCTT 0: 1
1: 0
2: 4
3: 16
4: 311
Right 1003827017 6:9964363-9964385 ACCCTTGTGTAAGACCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003827014 Original CRISPR AAGGGTAATCAAAGGGAAAC TGG (reversed) Intronic
902020881 1:13344746-13344768 AAAGGGAATCAAAAGGGAACAGG - Intronic
904420863 1:30390339-30390361 AAGGGGAAGCAGAGAGAAACTGG + Intergenic
905984465 1:42266447-42266469 AAGGCTATTCAATGAGAAACTGG + Intronic
908110837 1:60895625-60895647 AAAGGAAATCCAAGGGAAACAGG + Intronic
908386431 1:63646655-63646677 CAGGAGAATAAAAGGGAAACGGG - Intronic
908929109 1:69294989-69295011 AAGGTTAAACAAACGGAAATTGG + Intergenic
909005148 1:70267240-70267262 AACACTAATCAAAGGAAAACAGG - Intronic
909199332 1:72669811-72669833 AAAGGAAAAAAAAGGGAAACAGG + Intergenic
910296920 1:85656615-85656637 AAGCTTAAACAAAGTGAAACTGG + Intronic
910683169 1:89888753-89888775 AAGGTTTATCAGAGGGACACAGG + Intronic
911642618 1:100305010-100305032 AATGCTAATCAAAGGCAAAAAGG - Intergenic
912796434 1:112696286-112696308 AAGTGTAATTAAAGGGGTACCGG + Intronic
915769690 1:158407321-158407343 AAGGGTAATTTAAAGGAAATGGG + Intergenic
916559201 1:165918403-165918425 ACTGGTAATCAAAGGAAAAGAGG + Intergenic
916966083 1:169944628-169944650 GAGGGTAAGCAAAGGGGAAGAGG + Intronic
917210080 1:172622197-172622219 AAAGGAAAAAAAAGGGAAACAGG - Intergenic
918375988 1:183909583-183909605 AAGGGTCATAAAAGGAAGACAGG + Intronic
919874218 1:201850401-201850423 AAGCCTCATTAAAGGGAAACTGG - Intronic
921003887 1:211073048-211073070 AAAAGTAATCAAAGGAAAGCAGG + Intronic
922891019 1:229062120-229062142 AAGGGTAATGGAAGGAAAAGTGG - Intergenic
923439436 1:234002196-234002218 GAGGTTAATAATAGGGAAACTGG - Intronic
924153918 1:241156555-241156577 AAGGGGAAGGAAAGGGAAAGGGG + Intronic
1064800836 10:19069947-19069969 AAGGGAAATGAAAGGGAGAATGG - Intronic
1065160907 10:22920487-22920509 TAGGGGAAGCACAGGGAAACAGG - Intergenic
1066704232 10:38160101-38160123 AAGGCACATCAAAAGGAAACAGG - Intergenic
1066986387 10:42471775-42471797 AAGGCATATCAAAAGGAAACAGG + Intergenic
1068157217 10:53215739-53215761 AATGGTAATCAAAAGCAAGCAGG - Intergenic
1071744463 10:88400307-88400329 AAGGGAGATCAAAGGAAAATAGG - Intronic
1071953644 10:90733061-90733083 CAGGGCAATCCAAGGGAAAAAGG + Intergenic
1072287933 10:93934481-93934503 AAGGGGAAAAAAACGGAAACAGG - Intronic
1072493053 10:95927865-95927887 AAGGGCAACCCCAGGGAAACAGG - Intronic
1072843180 10:98797505-98797527 AAGGGTAATCTAAGAGATATTGG + Intronic
1073876532 10:107929118-107929140 AAGACTAATCTAAGGGAAAAAGG - Intergenic
1074223321 10:111459754-111459776 AGAGGTAAGCAAAAGGAAACAGG - Intergenic
1074429811 10:113384885-113384907 AAAAATAAGCAAAGGGAAACAGG + Intergenic
1074927538 10:118088553-118088575 AAGGGTCCTCAAAGCGAAGCAGG + Intergenic
1076230188 10:128813986-128814008 AATGGTCTTGAAAGGGAAACTGG - Intergenic
1077572358 11:3350857-3350879 AAGGATAATCAAAGAAAAATAGG + Intronic
1078464446 11:11539882-11539904 AAAGGAACTCAAAGGCAAACTGG + Intronic
1078626304 11:12962077-12962099 AAGGGTAAGAAAAGAGAAAAGGG + Intergenic
1078693939 11:13610496-13610518 GAAGGTACTCAAAGGGAAAAAGG - Intergenic
1079140767 11:17807969-17807991 CAGGGCTATCAAAGGGAAATGGG - Intronic
1079393625 11:20043236-20043258 AAGGCAGAACAAAGGGAAACGGG + Intronic
1079697828 11:23505709-23505731 AAGGGTAATAAACGGAAACCAGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082878124 11:58009173-58009195 AAGGGAAATAAATGGGATACAGG + Intergenic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1084900046 11:72302872-72302894 AAAGTAAATCAAAGGGACACGGG - Intronic
1087793268 11:102429834-102429856 GAGGGTAATAAAAGTGACACAGG - Intronic
1088226842 11:107629895-107629917 AAGGGAAAGCAGAGGGAAAGAGG + Intronic
1088259876 11:107934075-107934097 TAGGTTAATCAAAGTTAAACAGG - Intronic
1088348937 11:108862866-108862888 AAGGGTGATGAAAGGGACATTGG + Intronic
1091083905 11:132701464-132701486 AATGGGAATCAAAAGGAAGCAGG - Intronic
1091954388 12:4626292-4626314 AAGGCGTATCAAAGGGGAACAGG - Intronic
1092438765 12:8477614-8477636 AAGATTGATTAAAGGGAAACAGG - Exonic
1095381753 12:41603194-41603216 AAGAGGAATAAAATGGAAACAGG - Intergenic
1095655130 12:44660182-44660204 AAGGAAATTCAAAGGGGAACAGG + Intronic
1097130578 12:56808174-56808196 AAGGGCAATCCCAGGGAAATAGG - Intergenic
1097422753 12:59400764-59400786 AAGGGTAAAAGAAGAGAAACAGG - Intergenic
1097877478 12:64656963-64656985 AATGGTAGTCACAGGGAAATAGG + Intronic
1099079471 12:78158394-78158416 AAGGGCATGCAAATGGAAACTGG + Intronic
1099224543 12:79953917-79953939 AATGGTAACCAAAAGAAAACAGG - Intergenic
1099340200 12:81421936-81421958 AACGGTAATCAAAAGAAAGCTGG + Intronic
1099787981 12:87291891-87291913 AAATGTAATCAAAGGAAAGCTGG + Intergenic
1101038014 12:100724224-100724246 AAGTGGAATCAAAGGGACGCCGG + Intronic
1101954355 12:109200086-109200108 AAGGTTAATGACAGAGAAACTGG + Intronic
1102319804 12:111922585-111922607 AAAGGAAATAAAAGGCAAACAGG + Intergenic
1102929672 12:116852519-116852541 AAGGGGAAGCAGAGGGAAATGGG + Intronic
1102956733 12:117063730-117063752 AAGGGGAATCAGAGGGGCACTGG - Intronic
1104082934 12:125447029-125447051 AATAGTAATCAAAAGAAAACTGG - Intronic
1104877911 12:132049321-132049343 AAGAGTAAGCAAAGGGAAGCAGG - Intronic
1105667735 13:22578850-22578872 AAGGGTATTCAAATAGAAAGAGG + Intergenic
1105691673 13:22846573-22846595 ATAGGTAATCAAAGTGAAAAAGG + Intergenic
1105747574 13:23392139-23392161 AAGAGTCATCAAAAGGCAACAGG - Intronic
1105776007 13:23660985-23661007 AAAGTAATTCAAAGGGAAACTGG + Intronic
1107039736 13:35936078-35936100 AAGAGTATTCAAAGGGGGACAGG + Intronic
1107662965 13:42658462-42658484 AATGGAAAGTAAAGGGAAACAGG - Intergenic
1108297819 13:49042302-49042324 AAGAGTAATCAAAGATAACCAGG - Intronic
1108970877 13:56374568-56374590 AAGGCTCATCAAATGTAAACTGG - Intergenic
1110694456 13:78471919-78471941 AAGGGAACTCACAGGGAGACAGG - Intergenic
1111632565 13:90861240-90861262 AAGCATAATCAAAGGAAAAAGGG + Intergenic
1112804377 13:103146772-103146794 AAAGGTAATCACAGGGAGAGAGG - Intergenic
1112847362 13:103660502-103660524 AAGGGTATTCACTGGGAAAAAGG - Intergenic
1112880846 13:104104716-104104738 CAGGGAAATCAGAGGGAAAGGGG - Intergenic
1113074894 13:106458573-106458595 AAGGTCAAGCAAAGAGAAACAGG + Intergenic
1114384483 14:22241263-22241285 AAGGATCTTCAAAGGCAAACAGG - Intergenic
1114424357 14:22609980-22610002 AAGGGTGATCAAGGAGAAAGAGG + Intronic
1115178727 14:30596905-30596927 GAGGGTACTCAGAAGGAAACAGG - Intronic
1116055806 14:39862640-39862662 AAGGGAAAAAAGAGGGAAACAGG + Intergenic
1116537088 14:46045602-46045624 AATGGAAATCAAAAGGAAACAGG - Intergenic
1118203351 14:63698294-63698316 AAGGAAAATAAAAGGGAGACTGG + Intronic
1118594227 14:67423536-67423558 CAGGGAACTCAAAGGGAAAGTGG + Intergenic
1119622081 14:76138854-76138876 AAGGCCAGTCAAAGGGAAGCGGG - Intergenic
1119679940 14:76584729-76584751 AAGGGAAATGAAAGGGCAGCAGG + Intergenic
1122383352 14:101326466-101326488 AAGGGTAATCAGAGGACTACAGG - Intergenic
1123479531 15:20618105-20618127 AAGGAGAATCCAAGGAAAACTGG - Intergenic
1123638476 15:22382259-22382281 AAGGAGAATCCAAGGAAAACTGG + Intergenic
1124434786 15:29638129-29638151 AAGGGAAATCAAAAGGAATCTGG + Intergenic
1125083814 15:35706339-35706361 AAGGGCATTAAAATGGAAACAGG + Intergenic
1126160742 15:45611287-45611309 AAGGGCAATCAAAGAGAAGGTGG + Intronic
1126980264 15:54234349-54234371 AAGAATAATTAAAGTGAAACAGG - Intronic
1127273262 15:57420047-57420069 AAGGTATATCAAAGGGACACAGG - Intronic
1127323454 15:57869700-57869722 AACTTTAATCAAAGGGAAACGGG + Intergenic
1128039482 15:64558230-64558252 AGGGGAAATCAAAGGGTGACAGG - Intronic
1129552513 15:76468472-76468494 AAGGTTATTCAAAGGGAACTAGG + Intronic
1129801205 15:78415901-78415923 AAGGGCAGTTAAAAGGAAACAGG + Intergenic
1132008979 15:98257493-98257515 AAGGGAAATGGAAGGCAAACAGG - Intergenic
1132057029 15:98660088-98660110 AAAGGCAATCATGGGGAAACAGG - Intronic
1133135660 16:3709628-3709650 AAAGGGAAACAAAGGTAAACTGG - Intronic
1133445921 16:5860995-5861017 AAGGGATACCAAAGAGAAACTGG + Intergenic
1136594617 16:31239514-31239536 AAGGTTAATCAGAGGAAAAGGGG + Intergenic
1137012573 16:35337571-35337593 AAGGGAGAACAAAGGAAAACAGG - Intergenic
1139382196 16:66539640-66539662 AAGGATCAGCAAAGGGAAAAAGG + Intronic
1140216970 16:73016482-73016504 AAGGGTAATTCAAGCAAAACTGG + Intronic
1140793534 16:78414216-78414238 AGGGGTCAGCAAAGGGAAATAGG - Intronic
1141850696 16:86643592-86643614 AAGGCAAGTCAAAGGGAAAAGGG + Intergenic
1145367379 17:22276022-22276044 AAGGGAAAGAAAAGGGAAAAAGG - Intergenic
1146500504 17:33360468-33360490 AAGGGTATTCAGAGAGAAGCTGG - Intronic
1148293495 17:46478137-46478159 AAGGTTAATCAAAGAGAAGGTGG - Intergenic
1148315681 17:46695839-46695861 AAGGTTAATCAAAGAGAAGGTGG - Intronic
1150410158 17:64935627-64935649 AAGGGGAAGCAAAGGGGAAAAGG - Intergenic
1150538261 17:66068196-66068218 AATGCTAATCAAGGGGAAAAAGG + Intronic
1151798527 17:76363189-76363211 AAAGGCAATCAAAGTGAGACAGG + Intronic
1153751493 18:8236390-8236412 AACACTAATCAAAGGAAAACTGG - Intronic
1154375553 18:13806473-13806495 AAGGAAAACAAAAGGGAAACAGG + Intergenic
1155583049 18:27333425-27333447 AAAGGTGTTCAAAGTGAAACAGG + Intergenic
1156393590 18:36676124-36676146 AAGGGAAATCAAAGGGATAAGGG - Intronic
1156609309 18:38707732-38707754 AAGGGTAGTCAAAGTGGAATTGG - Intergenic
1156698363 18:39795277-39795299 AAGGGGAAAAAAGGGGAAACAGG + Intergenic
1156783976 18:40886864-40886886 AACAGTAATCAAAGGAAAGCAGG - Intergenic
1156920025 18:42510715-42510737 AAGGGAAATGAAAGGGTAAGTGG - Intergenic
1157683900 18:49627845-49627867 AAGGGGAAACAAAGAGAAAGAGG - Intergenic
1158931134 18:62325607-62325629 AAGGGCAAGCGGAGGGAAACTGG + Intronic
1160076310 18:75680814-75680836 AAGGGTAATGATAAGGACACAGG + Intergenic
1162255609 19:9487011-9487033 AAGGGAAAACAAAGGAAAAGAGG - Intronic
1167308987 19:48725573-48725595 AAGGGTAATGGGGGGGAAACTGG + Intronic
925285425 2:2712635-2712657 AAGGGTAATTTAAAGGAAAGGGG - Intergenic
925816766 2:7760466-7760488 AAGGGAAAAAAAGGGGAAACAGG - Intergenic
926502124 2:13668849-13668871 AAGGCAAATCAAAGGGAAGATGG + Intergenic
927143289 2:20144212-20144234 AATGGCAATCAGAGAGAAACTGG + Intergenic
928334497 2:30384787-30384809 AAGGGAAATCAGATGGAAAAGGG + Intergenic
931487057 2:62704881-62704903 AAGGGTGGTCAAAGGCAAAAAGG - Intronic
932945636 2:76226627-76226649 AAGGGTAATGAAAAGCAAATGGG + Intergenic
933262398 2:80145386-80145408 AAAGCTAATCAAAGGGAGAAGGG - Intronic
934506044 2:94895381-94895403 AAGAGTAATCAGAGGTAAAGTGG - Intergenic
937649006 2:124299064-124299086 AAAGGAAAGAAAAGGGAAACAGG + Intronic
938202886 2:129390755-129390777 AAGGATAATCAAAGTTAAAGAGG + Intergenic
938275102 2:130013249-130013271 AGTAGTAATCAAAGGAAAACTGG + Intergenic
938326061 2:130403978-130404000 AGTAGTAATCAAAGGAAAACTGG + Intergenic
938363881 2:130717487-130717509 AGTAGTAATCAAAGGAAAACTGG - Intergenic
938440266 2:131324032-131324054 AGTAGTAATCAAAGGAAAACTGG - Intronic
938850925 2:135258492-135258514 AAAAGAAATAAAAGGGAAACAGG - Intronic
942174718 2:173321445-173321467 AAGCATAATCAAAGGGAACATGG + Intergenic
942605989 2:177691517-177691539 AAGAGTACTCAAGGGGAAACTGG - Intronic
943957172 2:194207452-194207474 AAGGGTGATTATAAGGAAACAGG - Intergenic
946025031 2:216666508-216666530 AAGGGTAATGGAGGGGAAATGGG - Intergenic
946311969 2:218886968-218886990 AAGGGTAAGCCTGGGGAAACTGG - Intronic
947486368 2:230553175-230553197 AAGGGTATTCAAATGAAGACAGG + Intergenic
1169180299 20:3559957-3559979 AAGGATAAAAAAAGGGAAAAGGG - Intronic
1170062986 20:12278894-12278916 AAGGGAAATCAAAGGAGAGCAGG + Intergenic
1170227967 20:14012934-14012956 AAAGGTAAACAAAGGTAAAGAGG - Intronic
1170710360 20:18785289-18785311 GAGGAGAATCAAAGGGAAATTGG - Intergenic
1170721191 20:18880355-18880377 AAGGGTAATCAATAGGAAACAGG - Intergenic
1171314563 20:24177884-24177906 AATGGTATTCTAAAGGAAACAGG + Intergenic
1171417181 20:24990891-24990913 AAGGACAAACACAGGGAAACAGG + Intronic
1172402433 20:34660969-34660991 AAGGTGAATGAAAGGTAAACAGG + Intronic
1175591359 20:60194428-60194450 AAAGGTAATGAGAGGGAAAATGG - Intergenic
1178619285 21:34159687-34159709 AACTGTAATCAAAAGCAAACAGG - Intergenic
1181066513 22:20308895-20308917 AAAGGAAATAAAAGGGAAGCAGG - Intergenic
1181578412 22:23811070-23811092 AACGTTAATCAAAGGAAAGCAGG + Intronic
1182042134 22:27246435-27246457 AAGGGGATTGAAAGGGAAAGAGG + Intergenic
1185413785 22:50698853-50698875 AAGAGAGAACAAAGGGAAACTGG - Intergenic
949363018 3:3251940-3251962 AAAGGAAAAAAAAGGGAAACAGG + Intergenic
949571642 3:5299673-5299695 AAGGAAAAAAAAAGGGAAACAGG + Intergenic
949993162 3:9596161-9596183 AATGGGAAACAGAGGGAAACAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952786445 3:37160160-37160182 AAGGGTAAGCAATGGGAACAGGG + Intronic
952802315 3:37307119-37307141 AAGGTACATGAAAGGGAAACGGG - Intronic
953378917 3:42451951-42451973 AAAGGAAAAGAAAGGGAAACAGG + Intergenic
954078257 3:48196751-48196773 AGGGTTAATCAGAGTGAAACAGG + Intergenic
954290464 3:49647286-49647308 TAGGGTAAAGAAGGGGAAACGGG - Intronic
955459610 3:59167113-59167135 AATGGTCATCAATAGGAAACTGG + Intergenic
956502880 3:69906217-69906239 AAAGGCAATGAAAGGGAAAAAGG - Intronic
957980136 3:87498103-87498125 AAGGCTAACCAAAGGCAAATAGG - Intergenic
958475873 3:94581329-94581351 AAGGGTACTAATAGTGAAACAGG + Intergenic
958635827 3:96744461-96744483 AAGGGTTATTAAAGTGAGACAGG - Intergenic
958974659 3:100653988-100654010 AAAGGAAAAAAAAGGGAAACAGG + Intronic
959814333 3:110657953-110657975 AAGCATAAGCAAATGGAAACAGG - Intergenic
960286351 3:115833866-115833888 AAGGCTATTTAAAGGGAAATTGG - Intronic
961324717 3:126103345-126103367 AAGGGTAACCCCTGGGAAACAGG - Intergenic
961341068 3:126219547-126219569 AATGGTAATCAAAAGACAACAGG + Intergenic
962668545 3:137681123-137681145 ACAGGTAACCAAAGGGAAAATGG + Intergenic
963933243 3:151026169-151026191 AAGGTACATCAAAGGGACACTGG - Intergenic
964108760 3:153067429-153067451 GAAGGTACTCAAAGGGAAAAAGG + Intergenic
965039851 3:163492536-163492558 GAGAGGATTCAAAGGGAAACAGG - Intergenic
967674993 3:192287137-192287159 AACGTTAATCAAAAAGAAACAGG - Intronic
969433961 4:7173339-7173361 GAGGGTAAAGGAAGGGAAACAGG + Intergenic
969648099 4:8445423-8445445 AGGTGAAATCAAAGGGTAACAGG - Intronic
970261012 4:14225168-14225190 AGGGGAAATCAAAGGCAAAGAGG - Intergenic
970674664 4:18435373-18435395 AAGGGAAATCAAATGTAGACAGG - Intergenic
970998008 4:22290257-22290279 AAGGGTATTCAAATAAAAACAGG - Intergenic
971504872 4:27355654-27355676 CAGGGTAATCAAAGAGAAACGGG - Intergenic
973226477 4:47790448-47790470 AGGGGAAAAAAAAGGGAAACAGG - Intronic
973843043 4:54881874-54881896 AAGGGAAACAAAATGGAAACAGG - Intergenic
973926479 4:55743522-55743544 AAGGGTAATCAAAAGAAAACAGG + Intergenic
977348144 4:95844483-95844505 AATGTTAATAAAAGGGAAATTGG - Intergenic
977809343 4:101341605-101341627 AAGGATAATCAAATGGGAAATGG - Intronic
978555009 4:109970536-109970558 CAGGATAATCCATGGGAAACAGG + Intronic
979201860 4:117988007-117988029 GATGGGAAACAAAGGGAAACAGG + Intergenic
979935768 4:126692867-126692889 AAGGCTAATCAAAAGAAAGCTGG + Intergenic
980037024 4:127896508-127896530 AATGGAAATTAATGGGAAACAGG + Intronic
980488332 4:133490656-133490678 AAGGGTCATGGGAGGGAAACTGG + Intergenic
981169774 4:141607855-141607877 CAGGATAATCAATGTGAAACAGG - Intergenic
981720381 4:147795987-147796009 AAGGTCAATCAAAAGGAAGCTGG - Intronic
983711221 4:170718950-170718972 AAGAATAATCAAAGTGAAAAGGG - Intergenic
984220913 4:176973404-176973426 CAGGGAAAACACAGGGAAACTGG + Intergenic
984387047 4:179074188-179074210 AATGCTTATCAAAGGAAAACTGG + Intergenic
984414917 4:179446068-179446090 AAGGGGGAAAAAAGGGAAACAGG + Intergenic
984859023 4:184220119-184220141 AAGGGAAAGGAAAGGGAAAGGGG + Intronic
986068333 5:4257660-4257682 AAGCGTAAACACAGGGAAAGCGG + Intergenic
988457348 5:31398093-31398115 ACAGGAAATTAAAGGGAAACTGG - Intergenic
991447881 5:66719332-66719354 ATGGGAAATCACAGAGAAACAGG + Intronic
991675187 5:69083685-69083707 AAGGAAAAAAAAAGGGAAACAGG - Intergenic
993816031 5:92546626-92546648 AAGGGTAGTCAAATGGACAATGG - Intergenic
994782925 5:104116177-104116199 AAGGGGAAACAAAAGGAAAATGG + Intergenic
997151964 5:131506567-131506589 AAGGGTAATCAATGGCAATAAGG + Intronic
997981182 5:138468087-138468109 AAGGGGAAAGAAAGGGAAAAGGG + Exonic
998468467 5:142364568-142364590 AAGGTTAAGGTAAGGGAAACAGG - Intergenic
1002122846 5:177018959-177018981 AGGGATAATCCAAGGGATACAGG - Intronic
1002681894 5:180971096-180971118 AACGGTAATCAAAAGAAAATAGG + Intergenic
1003827014 6:9964346-9964368 AAGGGTAATCAAAGGGAAACTGG - Intronic
1004353317 6:14910230-14910252 TAGGGAAATTAAAGGGAAAAAGG + Intergenic
1004385277 6:15167389-15167411 AAGGGAAATCAATGAGAAAAAGG + Intergenic
1005274586 6:24202654-24202676 AAGGGTATTCAAATAGAAATAGG + Intronic
1005926439 6:30449442-30449464 AGGGGAAATGAAAGGGAAGCAGG + Intergenic
1005928161 6:30462014-30462036 AGGGGAAATGAAAGGGAAGCAGG + Intergenic
1006507915 6:34502351-34502373 AAGGAGAAACAGAGGGAAACAGG + Intronic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007085925 6:39145340-39145362 TGGGTTAATCAAAGTGAAACAGG - Intergenic
1008307736 6:49925465-49925487 AAGGGAAAGTAAAGGGAAAGTGG - Intergenic
1010368091 6:75076076-75076098 AAGGGAAAAGAAAAGGAAACAGG + Intergenic
1011300160 6:85865248-85865270 AAGGGAAATCAGAAAGAAACAGG - Intergenic
1011639768 6:89407853-89407875 GAGGGTAGTCTAATGGAAACGGG - Intronic
1011712174 6:90066013-90066035 AAGGGCAGTGAAAAGGAAACAGG - Intronic
1012242764 6:96892753-96892775 AAGGGTAAGCAAAAGGAAAAGGG - Intronic
1012249128 6:96960371-96960393 TAGGATAATCAAAGGTAAAGGGG - Intronic
1012694169 6:102356169-102356191 AAGGGTAAAAAAAGGGAAACAGG + Intergenic
1014368812 6:120579488-120579510 AAGGGTCATAAAAGGGATACAGG + Intergenic
1014471971 6:121827349-121827371 ATGGGAAATCAAAGGGATAGAGG + Intergenic
1015421320 6:133012796-133012818 AAAGGTAATCAAAAGGAGTCAGG + Intergenic
1016334246 6:142987211-142987233 AATGGTAATCATTCGGAAACTGG - Intergenic
1016434840 6:144025270-144025292 AAGGGTCATCAAAAGAAAAAAGG + Intronic
1017395795 6:153998489-153998511 AATAGTAATCAAAGGAAATCTGG - Intergenic
1017897151 6:158690437-158690459 AAAGCTAATAAAAAGGAAACTGG - Intronic
1018917171 6:168141119-168141141 AAGGGTAACCAAAGCAAAAATGG - Intergenic
1020904886 7:14052665-14052687 AAGGGAAAAAAAGGGGAAACAGG + Intergenic
1021304685 7:19017901-19017923 AATGGTAATAAAAAGGGAACAGG + Intergenic
1021398803 7:20184825-20184847 AAGTTTATTCAAAAGGAAACTGG + Intronic
1022489681 7:30807021-30807043 AAGGCTAAACAAAGTGACACTGG - Intronic
1023549437 7:41353530-41353552 ATGGGTAAACAAAGAGAAAGAGG - Intergenic
1024026662 7:45414984-45415006 TAGGGTAATTAAAGGCCAACAGG - Intergenic
1024737657 7:52323279-52323301 AAGGGGAAGCAAAGGGAAAATGG - Intergenic
1027113519 7:75460061-75460083 AAAGGCAAGAAAAGGGAAACAGG + Intronic
1027285769 7:76644655-76644677 AAAGGCAAGAAAAGGGAAACAGG + Intergenic
1027660650 7:80984432-80984454 AAGATAATTCAAAGGGAAACTGG - Intergenic
1028414798 7:90568079-90568101 AAGTGAAATCAAAGGGAAAGTGG + Intronic
1028639348 7:93025954-93025976 AAGGGTGGGCAAAGGGCAACAGG + Intergenic
1030136443 7:106255834-106255856 AAGGGGAAGAAAAGGGAAACAGG + Intronic
1030856836 7:114568705-114568727 AATGGTAATTTAAGGGATACAGG - Intronic
1032235890 7:130122539-130122561 AAGGGAAATCAAAAAGTAACTGG - Intronic
1032564230 7:132924968-132924990 AATGGAGATCAAAGGGATACAGG - Intronic
1032897645 7:136269131-136269153 AAGGAAAATTAAAGGAAAACAGG + Intergenic
1033390955 7:140926710-140926732 AAGGGTGATGAAAGGGGAAAAGG - Intergenic
1034082161 7:148289054-148289076 TGGGGTAATCAAAGGGAGACAGG - Intronic
1034504036 7:151471804-151471826 GAGGATATTCAAAGTGAAACAGG + Intronic
1037842403 8:22254642-22254664 TAGGCTCTTCAAAGGGAAACAGG + Intergenic
1038411355 8:27362055-27362077 AAGGAAGATCCAAGGGAAACAGG - Intronic
1040714202 8:50227371-50227393 AAGAGTAATCATTGTGAAACAGG + Intronic
1040758001 8:50804425-50804447 AAGGGAAATAAAAGGGAAATAGG - Intergenic
1040790833 8:51228023-51228045 CAGGGTAAGCAATGGCAAACGGG + Intergenic
1041681317 8:60595563-60595585 AATATTAATCAAAGGAAAACAGG + Intronic
1042639964 8:70923013-70923035 ATGTGTAATGAAGGGGAAACAGG - Intergenic
1043096794 8:75985406-75985428 AGGGGTAATAAAAGGGAGTCTGG - Intergenic
1043573590 8:81631391-81631413 AAGGGTAAAGAAAGAGAAATGGG - Intergenic
1045701667 8:104873559-104873581 AAGGATGATCAAGGAGAAACAGG - Intronic
1046640705 8:116727320-116727342 AAGTGCAAACAAAGGGAAAAAGG + Intronic
1047333217 8:123911525-123911547 AAGCTTGATCAAAGGCAAACAGG + Intronic
1048352355 8:133626440-133626462 AAGTGGAATGAAAGGAAAACTGG + Intergenic
1050615330 9:7395808-7395830 CTGGGTAAACTAAGGGAAACTGG + Intergenic
1050862009 9:10446777-10446799 ACGGGTATTTAAAAGGAAACTGG + Intronic
1052435927 9:28428902-28428924 AAGGATAACCAAAGGGAACTAGG - Intronic
1052744873 9:32430769-32430791 AAGGATAACGAAAGGAAAACAGG + Intronic
1053115893 9:35502011-35502033 AACAGTACTCAAAGGGAAAGAGG - Intronic
1054945585 9:70792607-70792629 GAGGGGAAACAAAGGGAGACAGG + Intronic
1055070259 9:72158693-72158715 AAGTATAATCAAAGGCAAATTGG - Intronic
1056061637 9:82889374-82889396 AAGAGTCAGCAAAGGGAAATTGG - Intergenic
1057332835 9:94131729-94131751 AATGTTAATAATAGGGAAACTGG + Intergenic
1057517036 9:95730444-95730466 AAGGTCAATCGAAAGGAAACAGG - Intergenic
1059082373 9:111264226-111264248 AAGGAGAATCAAAGAGAAAGTGG - Intergenic
1059345829 9:113627303-113627325 AAAGGGAAGCAAAGAGAAACTGG - Intergenic
1059542550 9:115144445-115144467 AAGGGTAAGTGAAGGGAAAGGGG - Intronic
1059690321 9:116678601-116678623 AAGGTTAAGCAAAGTGAAAAGGG + Intronic
1061228324 9:129294507-129294529 AAAGGAAATAAAAGGCAAACAGG - Intergenic
1061332787 9:129907136-129907158 AGGGCCAATCAAAAGGAAACTGG - Intronic
1062085639 9:134646641-134646663 AGGGCTCGTCAAAGGGAAACAGG - Intronic
1185847305 X:3449931-3449953 AAGGGAAATAATAGGGAATCTGG - Intergenic
1185889181 X:3809251-3809273 AAGAGTCAGCAAAGGGAGACAGG - Intergenic
1186832364 X:13403669-13403691 AAAGGTAAAAAACGGGAAACAGG - Intergenic
1188552373 X:31378057-31378079 AAGAGTCAGCAAAGGGAGACAGG - Intronic
1189069639 X:37849715-37849737 AAGGGTCTTGAGAGGGAAACAGG - Intronic
1189294618 X:39909742-39909764 AAGGGAGATGAAAGGGAAACAGG + Intergenic
1189770470 X:44420706-44420728 AAAGTTAATAAAAGAGAAACAGG + Intergenic
1190456935 X:50635790-50635812 AAGGGGGAAGAAAGGGAAACAGG + Intronic
1190553644 X:51611850-51611872 AAAGGTAATGTTAGGGAAACTGG + Intergenic
1190722437 X:53161166-53161188 ATGGGATATCAAAGGGAAAAAGG - Intergenic
1191172383 X:57460969-57460991 AATGGAAAGCAAAGGAAAACAGG + Intronic
1192418935 X:71011154-71011176 GAAGGTAATTAAATGGAAACAGG - Intergenic
1193254410 X:79330132-79330154 AAAGGGAAGTAAAGGGAAACAGG + Intergenic
1194097402 X:89658769-89658791 AAGGGAAGTGAAAGGCAAACAGG + Intergenic
1194920948 X:99762871-99762893 AAGTTTATTCAAAGGGAAAATGG + Intergenic
1195549781 X:106154385-106154407 AACAGTAATCAAAAGGAAGCTGG + Intergenic
1196318693 X:114262882-114262904 AAAGGTAATCAAAGCAAAAATGG + Intergenic
1196981886 X:121223420-121223442 AATGGTGATCCAAGGGAAGCGGG + Intergenic
1196992278 X:121343825-121343847 AAGGGTAAACAAAGGCAGTCTGG - Intergenic
1197837046 X:130705888-130705910 AAGGGGTAAAAAAGGGAAACGGG - Intronic
1198074976 X:133185415-133185437 AAGGGGAAAAAACGGGAAACAGG - Intergenic
1198264643 X:134998114-134998136 AAGGGTAAGCAGGGGGAAAATGG - Intergenic
1200416473 Y:2916800-2916822 AGGGGAAAATAAAGGGAAACAGG - Intronic
1200416720 Y:2919567-2919589 AGGGGAAAATAAAGGGAAACAGG - Intronic
1200450419 Y:3320146-3320168 AAGGGAAGTGAAAGGCAAACAGG + Intergenic
1201621600 Y:15965105-15965127 AAAGGAAATCAGAGGGAGACAGG + Intergenic
1202195720 Y:22297128-22297150 AAAGGTACACAAGGGGAAACAGG - Intergenic