ID: 1003828905

View in Genome Browser
Species Human (GRCh38)
Location 6:9983923-9983945
Sequence TATCATTAGGTTCTAAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003828905_1003828908 21 Left 1003828905 6:9983923-9983945 CCTTTACTTAGAACCTAATGATA 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1003828908 6:9983967-9983989 TCTGAAGATCTATTTGGTTTTGG 0: 1
1: 0
2: 2
3: 21
4: 241
1003828905_1003828907 15 Left 1003828905 6:9983923-9983945 CCTTTACTTAGAACCTAATGATA 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1003828907 6:9983961-9983983 TGTTCATCTGAAGATCTATTTGG 0: 1
1: 0
2: 1
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003828905 Original CRISPR TATCATTAGGTTCTAAGTAA AGG (reversed) Intronic
912575143 1:110663729-110663751 TAGCATTTGGTTCTTAGTATTGG - Intergenic
918659139 1:187067874-187067896 TAGCATCATGTACTAAGTAAAGG + Intergenic
918707263 1:187680859-187680881 AATCAGTTGGTTTTAAGTAAGGG + Intergenic
918709230 1:187705997-187706019 TATTATTAGTTTCTATGTAGGGG - Intergenic
918772265 1:188576661-188576683 AGTCATTAGATTCTAAGAAAGGG + Intergenic
919213692 1:194522220-194522242 TATCATTAGCATCTAATAAAAGG + Intergenic
920830576 1:209461381-209461403 TATCATCAGTTTCTAGGTAGAGG - Intergenic
922055407 1:222037786-222037808 TATCCTTAGCTTCTAAATATTGG - Intergenic
922069005 1:222172704-222172726 TACCCATAGGTTCAAAGTAAAGG + Intergenic
1064214273 10:13386484-13386506 AATGAGTAGGATCTAAGTAATGG + Intergenic
1065067943 10:21990928-21990950 AATCATTCAGTTCAAAGTAAAGG + Intronic
1065868697 10:29936492-29936514 TATCATTAATTTCTAATTATTGG - Intergenic
1067327202 10:45280904-45280926 TAACAATAGTTCCTAAGTAATGG - Intergenic
1067327429 10:45282710-45282732 TAACAATAGTTCCTAAGTAATGG - Intergenic
1068029294 10:51687213-51687235 TATGATTAGGTTCAAAGACAAGG + Intronic
1068380499 10:56247852-56247874 TATCAATAGGTACTTAGTAAAGG + Intergenic
1071786374 10:88904773-88904795 TATCATTATTTTCTTAGTCAAGG + Intronic
1072724783 10:97805852-97805874 TTTCTTTAGGTTCAAAATAATGG - Intergenic
1076932317 10:133540340-133540362 AATCTTTAGGTTCTAGGTGATGG - Intronic
1077617168 11:3684730-3684752 TAACATTAGTTTCTATTTAAAGG - Intronic
1078038757 11:7837338-7837360 TATCATTAGGTTCTTAAAGATGG + Intergenic
1079423703 11:20319173-20319195 AATTATTAGGTTGAAAGTAAGGG + Intergenic
1080231862 11:30025480-30025502 TAGAATTAGGTACTAAGTGAAGG - Intergenic
1080476520 11:32597131-32597153 TACCATTATGATCAAAGTAATGG - Intronic
1082213905 11:49543124-49543146 TATCAGTAGGTATTAAATAATGG - Intergenic
1082268040 11:50140992-50141014 TTTCATTAGGTTCTTAGGGAAGG - Intergenic
1086189582 11:84062976-84062998 TATAATTAGCTTCAAAGTCAAGG + Intronic
1086635699 11:89081366-89081388 TATCAGTAGGTATTAAATAACGG + Intergenic
1086667233 11:89497773-89497795 CATCAGTAGGGTCTCAGTAATGG + Intronic
1086882722 11:92168891-92168913 CATCATTATGTTCTATGTAAAGG - Intergenic
1087569033 11:99900630-99900652 CATCCATAGGTTCAAAGTAAAGG - Intronic
1087612373 11:100449786-100449808 TATAATTATATTCTAAGTCATGG - Intergenic
1087851151 11:103030975-103030997 TCTCACTAGTTTCTAAGTAGTGG - Intergenic
1088545462 11:110954555-110954577 TATAATTGGGTTCTATTTAAGGG + Intergenic
1089187016 11:116624984-116625006 TATGACTAAGTTCTAAGCAATGG + Intergenic
1091605779 12:1950059-1950081 TATCATTTGCTTCTAACTCAGGG + Intronic
1093163337 12:15775649-15775671 AAGCATCAGGTTCTAGGTAAGGG - Intronic
1093439242 12:19173873-19173895 AAACATTAGGTTTTAAGTATTGG + Intronic
1095334510 12:41009690-41009712 CATCATCAGGTTATTAGTAATGG + Intronic
1095640336 12:44479394-44479416 TATCTTTAGGTTATTAATAATGG - Intergenic
1096744701 12:53718356-53718378 TTTCATTACCTTTTAAGTAAAGG + Intronic
1097870079 12:64594512-64594534 TTTCATTACCTTTTAAGTAAAGG - Intergenic
1099630952 12:85144758-85144780 TATTATTGGGTTTCAAGTAAGGG + Intronic
1101513916 12:105417304-105417326 AATCATTTGACTCTAAGTAAAGG - Intergenic
1101700217 12:107166910-107166932 CATCTGTAGGTTTTAAGTAAGGG - Intergenic
1102743827 12:115232113-115232135 TATCATAAGTTTGTATGTAAAGG - Intergenic
1105819984 13:24071715-24071737 TTTCATTGTATTCTAAGTAAGGG + Intronic
1105878187 13:24578722-24578744 CACCAATAGGTTCAAAGTAAAGG - Intergenic
1105922016 13:24971899-24971921 CACCAATAGGTTCAAAGTAAAGG + Intergenic
1108634534 13:52319348-52319370 TATTATAAAGTTCTATGTAAGGG + Intergenic
1110060864 13:71035813-71035835 CATCCATAGGTTCAAAGTAAAGG + Intergenic
1110111723 13:71755851-71755873 TATCATAAGTTTAAAAGTAATGG - Intronic
1112129066 13:96501278-96501300 TAAAATTGGGTTCTAAATAAAGG + Intronic
1116322200 14:43482432-43482454 TGTCATTAGATTTGAAGTAAAGG + Intergenic
1117879282 14:60294432-60294454 TATGATAATGTTCTAAGTTATGG + Intronic
1118117361 14:62795674-62795696 CTTCAATAGGTTCTCAGTAAAGG - Intronic
1120491888 14:85188878-85188900 TATCCTTACATTCTAATTAAAGG - Intergenic
1126257344 15:46643511-46643533 CATCCTTAGGTTCTATGTATGGG + Intergenic
1126263197 15:46718838-46718860 TATGAATAGGTTCAAAGTAGTGG - Intergenic
1126481496 15:49126806-49126828 TTTCATTTGGTGCCAAGTAATGG + Intronic
1127131653 15:55870816-55870838 TTTCATAAGGTTCTAATTTAAGG + Intronic
1129130343 15:73487905-73487927 CATCCTTTGATTCTAAGTAAAGG + Intronic
1137558327 16:49487354-49487376 TATCAGTAGGATATAAATAACGG - Intergenic
1138258577 16:55594967-55594989 TACCAATAGGCTCAAAGTAAAGG + Intergenic
1139193242 16:64889053-64889075 TGTCAGTGGGTTCTAAGGAAAGG + Intergenic
1140491413 16:75339286-75339308 TTTAATGAGGTTCTAACTAAAGG + Intronic
1144161373 17:12563146-12563168 TATCTTTTTTTTCTAAGTAAAGG + Intergenic
1150611654 17:66738433-66738455 TATAATAAATTTCTAAGTAAGGG - Intronic
1155576515 18:27253811-27253833 TATCATTTGATACTAAGAAATGG + Intergenic
1155614782 18:27709212-27709234 CATCAATAGGCTCAAAGTAAAGG - Intergenic
1156169179 18:34461843-34461865 TATAATTAGGTTCCAAGGGAAGG - Intergenic
1157351750 18:46894152-46894174 TATCAGTAAGTGCTAAATAAAGG - Intronic
1158139107 18:54238229-54238251 TATCATTAGGTTGTTAGTGAAGG - Intergenic
1159255232 18:65936560-65936582 AATCATTAGTTTCTAAAAAATGG + Intergenic
1162258317 19:9511343-9511365 TAACAATAGTTCCTAAGTAATGG + Intergenic
1165002784 19:32778874-32778896 AATCAGTGGGTTCTAAGTAAAGG - Intronic
925849475 2:8067107-8067129 TATGATCAGGTTCTAAGGTAAGG - Intergenic
927744786 2:25608624-25608646 GATCATTAGGTTAAAAGGAATGG + Intronic
927788597 2:25992004-25992026 ACCCATTAGGTTCTCAGTAAAGG - Intergenic
931013940 2:57952909-57952931 TATCATTGTCTTCTAAGTCAAGG - Intronic
933929076 2:87130283-87130305 TACCATTAGCTTCTAAGTCAGGG + Intergenic
934000407 2:87706059-87706081 TACCATTAGCTTCTAAGTCAGGG + Intergenic
936363866 2:111833109-111833131 TACCATTAGCTTCTAAGTCAGGG - Intronic
939778515 2:146415251-146415273 TGTCATTTGTTTCTAATTAAAGG - Intergenic
940243291 2:151586750-151586772 AATCAGTAGATTCCAAGTAAAGG + Intronic
940244247 2:151597303-151597325 AATCAGTAGATTCCAAGTAAAGG + Intronic
940245203 2:151607849-151607871 AATCAGTAGATTCCAAGTAAAGG + Intronic
941026264 2:160459718-160459740 AAACATTACTTTCTAAGTAATGG - Intronic
941233169 2:162937888-162937910 TATCATTTGAATTTAAGTAATGG - Intergenic
941617880 2:167741986-167742008 TGTCATCAGTTTCTCAGTAAGGG - Intergenic
942408680 2:175683688-175683710 TCTCATTACATTCTAAGTCACGG - Intergenic
943415400 2:187596187-187596209 TATCATTATTTTCTCAGTGACGG - Intergenic
947480161 2:230491835-230491857 TGTCATTAGGTTCTAGCCAATGG + Intronic
1169664010 20:8014533-8014555 TATTATAAGCTTTTAAGTAAAGG - Intronic
1169671139 20:8104119-8104141 TATCCATAGGCTCAAAGTAAAGG - Intergenic
1171240016 20:23559607-23559629 TATGAATAGGTTGAAAGTAAAGG - Intergenic
1174444344 20:50580377-50580399 TATCAATAGGTACTCAATAATGG - Intronic
1175160619 20:57005118-57005140 TATCAATAGCTTCTCAGTAAGGG - Intergenic
1177673636 21:24267878-24267900 TATTTTGAGGATCTAAGTAATGG + Intergenic
1178782312 21:35615146-35615168 ACTCATTAGCTTCTAAGTATGGG + Intronic
1183502844 22:38191372-38191394 TATCATTAGTTTCTAAGAACAGG - Intronic
951825387 3:26862655-26862677 TAGCATTTGGCTCTTAGTAAAGG - Intergenic
952470289 3:33641856-33641878 TGTGATTAGCTTCTAATTAAAGG - Intronic
953467114 3:43131792-43131814 TATCAGTAGTTTCTAAGTCATGG - Intergenic
957593688 3:82232899-82232921 TATCAGTAAGTTAGAAGTAATGG - Intergenic
958076197 3:88682220-88682242 AATCATTAGGTACTAAATCATGG + Intergenic
960380405 3:116953699-116953721 TATTATTTTGTGCTAAGTAATGG - Intronic
961595906 3:128016265-128016287 GAGCATTAGATTCTAAATAAGGG + Intergenic
961904926 3:130253017-130253039 TTGCCTTAGGTTCTGAGTAAAGG + Intergenic
964158435 3:153615998-153616020 TCTCATTAGGTTTTACATAAAGG + Intergenic
964985148 3:162728632-162728654 TAAAATTAGTTTCTAAGCAAAGG - Intergenic
965863840 3:173181540-173181562 TAACATTTGCTTCTAAGTAGAGG + Intergenic
966336969 3:178879207-178879229 TTTCATATGGTTCTAAGTATTGG - Intergenic
966580440 3:181556245-181556267 TATAATTAGATTCTATCTAAAGG - Intergenic
973016868 4:45150786-45150808 TTTCATTAGGTTTTAATGAAAGG + Intergenic
974323109 4:60377943-60377965 TATCACCAGTTTCTCAGTAAAGG - Intergenic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
975737570 4:77396490-77396512 TAACAATAGCTCCTAAGTAATGG + Intronic
977440262 4:97057092-97057114 TCTTGTTAGGGTCTAAGTAATGG + Intergenic
979873266 4:125853002-125853024 TATCATTAGCTTCTATTTCAAGG - Intergenic
980091163 4:128444322-128444344 TATCCTTAGGCTCAAAGTAAAGG - Intergenic
980581812 4:134764008-134764030 AATCAGTTGGCTCTAAGTAAAGG + Intergenic
981275742 4:142897303-142897325 TCTCAATAGGCTCAAAGTAAAGG - Intergenic
981320715 4:143388086-143388108 TATCCTTAGGTTGTAAGGGAAGG - Intronic
982371730 4:154640769-154640791 CATCATTTGGTTCTAACTGATGG + Intronic
982867523 4:160535304-160535326 TATAAATAGGTTAAAAGTAAAGG - Intergenic
983180628 4:164644038-164644060 CATAATTAGCTTTTAAGTAATGG + Intergenic
983477783 4:168236566-168236588 GATCATTAGGATCTAAATTAGGG - Intronic
986115269 5:4767637-4767659 TATTCTTAAGTTATAAGTAAAGG - Intergenic
986288061 5:6375372-6375394 TATCATTAGGTTACTACTAATGG + Intronic
987703521 5:21432221-21432243 TATCAGTAGTTTATAAGTAATGG + Intergenic
987868052 5:23572425-23572447 TCTCATTGGATTATAAGTAAAGG + Intergenic
988163336 5:27550047-27550069 CATCCATAGGTTCAAAGTAAAGG - Intergenic
989266668 5:39482579-39482601 TGTCCTTGGGTTCTAAGGAATGG + Intergenic
991439423 5:66631170-66631192 AATGAATAGGTTGTAAGTAAAGG + Intronic
992209853 5:74468104-74468126 TATGATTAGGTTGTAATTATAGG - Intergenic
994646473 5:102475972-102475994 TATCATTATGTTCTCAGAAGTGG + Intronic
995368367 5:111389379-111389401 TTTCATTTGGCTCTAAGTTAGGG - Intronic
997121411 5:131176778-131176800 TATAAGTAGGTGCTAAGCAAAGG - Intronic
997462180 5:134060193-134060215 TATTATTAGTTCCTAAGAAATGG - Intergenic
998115119 5:139531252-139531274 TAACATCAGTTTCTAAGTTATGG - Intronic
1000485167 5:161832551-161832573 TTTCAGAAGTTTCTAAGTAAAGG + Intergenic
1000910461 5:167015587-167015609 TATGATAATTTTCTAAGTAATGG - Intergenic
1001011026 5:168098439-168098461 AATCATTAACTTCTATGTAATGG + Intronic
1003828905 6:9983923-9983945 TATCATTAGGTTCTAAGTAAAGG - Intronic
1008931982 6:56950390-56950412 TACCATTAGATTATAAGAAAGGG - Intronic
1010570796 6:77472279-77472301 TATCATTATGTTCTTAGCTATGG - Intergenic
1010965251 6:82198088-82198110 TTTCCTTAGGTTTAAAGTAAGGG + Intronic
1011003128 6:82614054-82614076 TCTAATTAATTTCTAAGTAATGG - Intergenic
1012388824 6:98713252-98713274 TACAAATAGGTTCAAAGTAAAGG + Intergenic
1013240616 6:108241901-108241923 TATCAATATGTTCAAATTAAAGG + Intronic
1015281244 6:131436148-131436170 CATCCATAGGTTCAAAGTAAAGG + Intergenic
1015674006 6:135724566-135724588 TATCTATAGGTTCTAATTGAGGG - Intergenic
1015765499 6:136711751-136711773 TCTCGTTGGGTTCTATGTAAAGG + Intronic
1015910792 6:138165671-138165693 TCTCCTGAGGGTCTAAGTAAGGG - Intronic
1020543429 7:9491915-9491937 CATCCTTAGGCTCAAAGTAAAGG - Intergenic
1020899302 7:13984712-13984734 TATAATTCTTTTCTAAGTAAAGG + Intronic
1022145298 7:27532170-27532192 TATCTTTAGAATCCAAGTAATGG - Intronic
1024429306 7:49267506-49267528 TATAATTAGCTTTTAAGCAAAGG + Intergenic
1024601731 7:50988027-50988049 TAACATTATATTATAAGTAAAGG + Intergenic
1028145172 7:87313172-87313194 TTTCATTTTGTTCAAAGTAAAGG + Intergenic
1031714839 7:125096210-125096232 TATAATTAGGTTCTTGGTGAGGG + Intergenic
1033898795 7:146110518-146110540 TATTATCTGGTTCTAAATAATGG - Intergenic
1034389839 7:150777410-150777432 TTTCATCATTTTCTAAGTAAAGG + Intergenic
1035907288 8:3527209-3527231 TAACATTTGGTTCTGAGTAGTGG - Intronic
1037407558 8:18559545-18559567 TATCATTGGATTCTAATTATTGG - Intronic
1041596677 8:59662820-59662842 TATGACTTTGTTCTAAGTAAGGG + Intergenic
1043386568 8:79754531-79754553 GACCATAAGGTTCTAAGTGATGG + Intergenic
1044219069 8:89648674-89648696 TATCATTTGTTTCTAGGGAAGGG - Intergenic
1045178313 8:99751139-99751161 CATAATTAGCTCCTAAGTAAGGG - Intronic
1046647285 8:116800088-116800110 TATCATCAGTTTTTAAATAAGGG + Intronic
1046861670 8:119099718-119099740 TATTATTAAGTTCTAGCTAAGGG + Intronic
1048903963 8:139069028-139069050 TATCAGTAGGGTCTCAGAAATGG + Intergenic
1049678936 8:143907388-143907410 TGTCATTTGATTTTAAGTAAAGG - Intergenic
1050912340 9:11087397-11087419 TTTCATCAAGTACTAAGTAAAGG - Intergenic
1052551120 9:29950740-29950762 CATCCATAGGTTCAAAGTAAAGG - Intergenic
1055995514 9:82154722-82154744 TATCATTAGTTACTATGTCATGG - Intergenic
1186865462 X:13716510-13716532 TATCCTTACCTTCTTAGTAAAGG - Intronic
1188580555 X:31707126-31707148 TTTCATTAGGTTCCAAATAACGG - Intronic
1192032003 X:67523877-67523899 ACTCATTAGGTTTTCAGTAAAGG - Intergenic
1192489017 X:71557878-71557900 TATCATTAGTGTTTAAGTGAAGG - Intronic
1197114242 X:122813792-122813814 TAACATCAGTTTCTAAGTCATGG + Intergenic
1200821170 Y:7583961-7583983 TTTCAATAGGTTCAAGGTAAAGG + Intergenic
1200922328 Y:8624281-8624303 TACCATTATGTTTTAATTAATGG + Intergenic
1202239132 Y:22748781-22748803 TTTCAATAGGTTCAAGGTAAAGG - Intergenic
1202392120 Y:24382548-24382570 TTTCAATAGGTTCAAGGTAAAGG - Intergenic
1202478664 Y:25287569-25287591 TTTCAATAGGTTCAAGGTAAAGG + Intergenic